EMAIL THIS PAGE TO A FRIEND

A430105I19Rik

13 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU055471 MISSION® esiRNA targeting mouse Ccdc9b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001982 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286251 predicted 1054
2 SASI_Mm02_00286252 predicted 235
3 SASI_Mm01_00095381 predicted 1349
4 SASI_Mm01_00095382 predicted 1153
5 SASI_Mm01_00095383 predicted 1798
6 SASI_Mm01_00095384 predicted 1939
7 SASI_Mm01_00095385 predicted 1564
8 SASI_Mm01_00095386 predicted 1740
9 SASI_Mm01_00095387 predicted 1916
10 SASI_Mm01_00095388 predicted 1785
11 SASI_Mm01_00095389 predicted 1140
12 SASI_Mm01_00095390 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001982
A430105I19Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-500s1c1
Sequence:CCGGGACTACACGCAGTGGAAACAACTCGAGTTGTTTCCACTGCGTGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-809s1c1
Sequence:CCGGGCCCGAAGGTATGACATGAAACTCGAGTTTCATGTCATACCTTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001982.1-3101s1c1
Sequence:CCGGGCCCGAGTGTAGAATCCAAATCTCGAGATTTGGATTCTACACTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001982.1-4264s1c1
Sequence:CCGGCCTCTCATCTACCTTGCTCAACTCGAGTTGAGCAAGGTAGATGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-514s1c1
Sequence:CCGGGAAACAAGAGAGAGAGCAGATCTCGAGATCTGCTCTCTCTCTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001982
A430105I19Rik MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-500s1c1
Sequence:CCGGGACTACACGCAGTGGAAACAACTCGAGTTGTTTCCACTGCGTGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-809s1c1
Sequence:CCGGGCCCGAAGGTATGACATGAAACTCGAGTTTCATGTCATACCTTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001982.1-3101s1c1
Sequence:CCGGGCCCGAGTGTAGAATCCAAATCTCGAGATTTGGATTCTACACTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001982.1-4264s1c1
Sequence:CCGGCCTCTCATCTACCTTGCTCAACTCGAGTTGAGCAAGGTAGATGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-514s1c1
Sequence:CCGGGAAACAAGAGAGAGAGCAGATCTCGAGATCTGCTCTCTCTCTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001982
A430105I19Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-500s1c1
Sequence:CCGGGACTACACGCAGTGGAAACAACTCGAGTTGTTTCCACTGCGTGTAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-809s1c1
Sequence:CCGGGCCCGAAGGTATGACATGAAACTCGAGTTTCATGTCATACCTTCGGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001982.1-3101s1c1
Sequence:CCGGGCCCGAGTGTAGAATCCAAATCTCGAGATTTGGATTCTACACTCGGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001982.1-4264s1c1
Sequence:CCGGCCTCTCATCTACCTTGCTCAACTCGAGTTGAGCAAGGTAGATGAGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001982.1-514s1c1
Sequence:CCGGGAAACAAGAGAGAGAGCAGATCTCGAGATCTGCTCTCTCTCTTGTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???