EMAIL THIS PAGE TO A FRIEND

A530013C23Rik

11 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU177411 MISSION® esiRNA targeting mouse A530013c23rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147302 predicted 766
2 SASI_Mm01_00147303 predicted 508
3 SASI_Mm01_00147304 predicted 736
4 SASI_Mm01_00147305 predicted 938
5 SASI_Mm01_00147306 predicted 492
6 SASI_Mm01_00147307 predicted 378
7 SASI_Mm01_00147308 predicted 675
8 SASI_Mm01_00147309 predicted 403
9 SASI_Mm01_00147310 predicted 827
10 SASI_Mm01_00147311 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177851
A530013C23Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-208s1c1
Sequence:CCGGGTGTGTGTGACAGAAGCAAACCTCGAGGTTTGCTTCTGTCACACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-588s1c1
Sequence:CCGGGAATTTCCAGTTTGAAGGCTACTCGAGTAGCCTTCAAACTGGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-540s1c1
Sequence:CCGGCCTGGAAATGGTTCTTGGTTTCTCGAGAAACCAAGAACCATTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-496s1c1
Sequence:CCGGGCCTTAGTTGGGAAGTTCTATCTCGAGATAGAACTTCCCAACTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177851
A530013C23Rik MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-208s1c1
Sequence:CCGGGTGTGTGTGACAGAAGCAAACCTCGAGGTTTGCTTCTGTCACACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-588s1c1
Sequence:CCGGGAATTTCCAGTTTGAAGGCTACTCGAGTAGCCTTCAAACTGGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-540s1c1
Sequence:CCGGCCTGGAAATGGTTCTTGGTTTCTCGAGAAACCAAGAACCATTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-496s1c1
Sequence:CCGGGCCTTAGTTGGGAAGTTCTATCTCGAGATAGAACTTCCCAACTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177851
A530013C23Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-208s1c1
Sequence:CCGGGTGTGTGTGACAGAAGCAAACCTCGAGGTTTGCTTCTGTCACACACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-588s1c1
Sequence:CCGGGAATTTCCAGTTTGAAGGCTACTCGAGTAGCCTTCAAACTGGAAATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-540s1c1
Sequence:CCGGCCTGGAAATGGTTCTTGGTTTCTCGAGAAACCAAGAACCATTTCCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177851.2-496s1c1
Sequence:CCGGGCCTTAGTTGGGAAGTTCTATCTCGAGATAGAACTTCCCAACTAAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???