EMAIL THIS PAGE TO A FRIEND

A530016L24Rik

11 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087261 MISSION® esiRNA targeting mouse A530016l24rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199657 predicted 385
2 SASI_Mm01_00199658 predicted 352
3 SASI_Mm01_00199659 predicted 882
4 SASI_Mm01_00199660 predicted 925
5 SASI_Mm01_00199661 predicted 1244
6 SASI_Mm01_00199662 predicted 890
7 SASI_Mm01_00199663 predicted 450
8 SASI_Mm01_00199664 predicted 1047
9 SASI_Mm01_00199665 predicted 1110
10 SASI_Mm01_00199666 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177039
A530016L24Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-355s21c1
Sequence:CCGGAGGACTGAGAGGGATGGTAACCTCGAGGTTACCATCCCTCTCAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-400s21c1
Sequence:CCGGAGACCCAGACGGCAAGAATGTCTCGAGACATTCTTGCCGTCTGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-696s21c1
Sequence:CCGGTCAGCTCCTCGCCCTAATCTTCTCGAGAAGATTAGGGCGAGGAGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177039.3-1049s21c1
Sequence:CCGGAGAAAGAACTCGACCATTATACTCGAGTATAATGGTCGAGTTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-481s21c1
Sequence:CCGGGAGGTGGCTGTCCACTACATTCTCGAGAATGTAGTGGACAGCCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177039.2-368s1c1
Sequence:CCGGGATGGTAACAGGAAGTGTCCTCTCGAGAGGACACTTCCTGTTACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177039.2-1047s1c1
Sequence:CCGGCAGAGAAAGAACTCGACCATTCTCGAGAATGGTCGAGTTCTTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177039
A530016L24Rik MISSION shRNA shRNA Plasmid DNA
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-355s21c1
Sequence:CCGGAGGACTGAGAGGGATGGTAACCTCGAGGTTACCATCCCTCTCAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-400s21c1
Sequence:CCGGAGACCCAGACGGCAAGAATGTCTCGAGACATTCTTGCCGTCTGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-696s21c1
Sequence:CCGGTCAGCTCCTCGCCCTAATCTTCTCGAGAAGATTAGGGCGAGGAGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177039.3-1049s21c1
Sequence:CCGGAGAAAGAACTCGACCATTATACTCGAGTATAATGGTCGAGTTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-481s21c1
Sequence:CCGGGAGGTGGCTGTCCACTACATTCTCGAGAATGTAGTGGACAGCCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177039.2-368s1c1
Sequence:CCGGGATGGTAACAGGAAGTGTCCTCTCGAGAGGACACTTCCTGTTACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177039.2-1047s1c1
Sequence:CCGGCAGAGAAAGAACTCGACCATTCTCGAGAATGGTCGAGTTCTTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177039
A530016L24Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-355s21c1
Sequence:CCGGAGGACTGAGAGGGATGGTAACCTCGAGGTTACCATCCCTCTCAGTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000281642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-400s21c1
Sequence:CCGGAGACCCAGACGGCAAGAATGTCTCGAGACATTCTTGCCGTCTGGGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-696s21c1
Sequence:CCGGTCAGCTCCTCGCCCTAATCTTCTCGAGAAGATTAGGGCGAGGAGCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177039.3-1049s21c1
Sequence:CCGGAGAAAGAACTCGACCATTATACTCGAGTATAATGGTCGAGTTCTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177039.3-481s21c1
Sequence:CCGGGAGGTGGCTGTCCACTACATTCTCGAGAATGTAGTGGACAGCCACCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177039.2-368s1c1
Sequence:CCGGGATGGTAACAGGAAGTGTCCTCTCGAGAGGACACTTCCTGTTACCATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192301    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177039.2-1047s1c1
Sequence:CCGGCAGAGAAAGAACTCGACCATTCTCGAGAATGGTCGAGTTCTTTCTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???