EMAIL THIS PAGE TO A FRIEND

A530032D15Rik

7 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_213615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_213615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164931 MISSION® esiRNA targeting mouse A530032d15rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352289 predicted 1142
2 SASI_Mm02_00352290 predicted 894
3 SASI_Mm02_00352291 predicted 1200
4 SASI_Mm02_00352292 predicted 1204
5 SASI_Mm02_00352293 predicted 1175
6 SASI_Mm02_00352294 predicted 1160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213615
A530032D15Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213615.1-1143s1c1
Sequence:CCGGGCTTGCCTCTTGTTTCCTGAACTCGAGTTCAGGAAACAAGAGGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1561s21c1
Sequence:CCGGTGTCCAAGGATACTTAGTTTACTCGAGTAAACTAAGTATCCTTGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1371s21c1
Sequence:CCGGGTGTCTTTGCAATTCTTATTTCTCGAGAAATAAGAATTGCAAAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1243s21c1
Sequence:CCGGGTGTGCTGTGACGGGATTTGACTCGAGTCAAATCCCGTCACAGCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213615.1-535s1c1
Sequence:CCGGCAGAATGAAGAGGAGTCAGATCTCGAGATCTGACTCCTCTTCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213615.1-1154s1c1
Sequence:CCGGGTTTCCTGAATAGTGGGATTACTCGAGTAATCCCACTATTCAGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213615.1-898s1c1
Sequence:CCGGCCACAATGCAATGGAGGAGTTCTCGAGAACTCCTCCATTGCATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1403s21c1
Sequence:CCGGTATAGTGGAAAGCACAAATCCCTCGAGGGATTTGTGCTTTCCACTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000452868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1331s21c1
Sequence:CCGGCACCCTTCTATTTGAACATATCTCGAGATATGTTCAAATAGAAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213615
A530032D15Rik MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213615.1-1143s1c1
Sequence:CCGGGCTTGCCTCTTGTTTCCTGAACTCGAGTTCAGGAAACAAGAGGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1561s21c1
Sequence:CCGGTGTCCAAGGATACTTAGTTTACTCGAGTAAACTAAGTATCCTTGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1371s21c1
Sequence:CCGGGTGTCTTTGCAATTCTTATTTCTCGAGAAATAAGAATTGCAAAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1243s21c1
Sequence:CCGGGTGTGCTGTGACGGGATTTGACTCGAGTCAAATCCCGTCACAGCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213615.1-535s1c1
Sequence:CCGGCAGAATGAAGAGGAGTCAGATCTCGAGATCTGACTCCTCTTCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213615.1-1154s1c1
Sequence:CCGGGTTTCCTGAATAGTGGGATTACTCGAGTAATCCCACTATTCAGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213615.1-898s1c1
Sequence:CCGGCCACAATGCAATGGAGGAGTTCTCGAGAACTCCTCCATTGCATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1403s21c1
Sequence:CCGGTATAGTGGAAAGCACAAATCCCTCGAGGGATTTGTGCTTTCCACTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000452868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1331s21c1
Sequence:CCGGCACCCTTCTATTTGAACATATCTCGAGATATGTTCAAATAGAAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213615
A530032D15Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213615.1-1143s1c1
Sequence:CCGGGCTTGCCTCTTGTTTCCTGAACTCGAGTTCAGGAAACAAGAGGCAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000449828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1561s21c1
Sequence:CCGGTGTCCAAGGATACTTAGTTTACTCGAGTAAACTAAGTATCCTTGGACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000453073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1371s21c1
Sequence:CCGGGTGTCTTTGCAATTCTTATTTCTCGAGAAATAAGAATTGCAAAGACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000448220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1243s21c1
Sequence:CCGGGTGTGCTGTGACGGGATTTGACTCGAGTCAAATCCCGTCACAGCACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000178800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213615.1-535s1c1
Sequence:CCGGCAGAATGAAGAGGAGTCAGATCTCGAGATCTGACTCCTCTTCATTCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213615.1-1154s1c1
Sequence:CCGGGTTTCCTGAATAGTGGGATTACTCGAGTAATCCCACTATTCAGGAAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213615.1-898s1c1
Sequence:CCGGCCACAATGCAATGGAGGAGTTCTCGAGAACTCCTCCATTGCATTGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000443255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1403s21c1
Sequence:CCGGTATAGTGGAAAGCACAAATCCCTCGAGGGATTTGTGCTTTCCACTATATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000452868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_213615.2-1331s21c1
Sequence:CCGGCACCCTTCTATTTGAACATATCTCGAGATATGTTCAAATAGAAGGGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???