EMAIL THIS PAGE TO A FRIEND

A530054K11Rik

17 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU146421 MISSION® esiRNA targeting mouse Zfp729a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350171 predicted 2886
2 SASI_Mm02_00350172 predicted 1303
3 SASI_Mm02_00350173 predicted 2211
4 SASI_Mm02_00350174 predicted 795
5 SASI_Mm02_00350175 predicted 776
6 SASI_Mm02_00350176 predicted 1254
7 SASI_Mm01_00107439 predicted 1246
8 SASI_Mm02_00350177 predicted 2057
9 SASI_Mm02_00350178 predicted 1954
10 SASI_Mm02_00350179 predicted 806
11 SASI_Mm01_00107440 predicted 2463
12 SASI_Mm01_00107441 predicted 1264
13 SASI_Mm01_00107442 predicted 3096
14 SASI_Mm01_00107443 predicted 3093
15 SASI_Mm01_00107444 predicted 3068
16 SASI_Mm01_00107445 predicted 112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183146
A530054K11Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-1949s1c1
Sequence:CCGGCCTATAACAGTCAAGTATGTACTCGAGTACATACTTGACTGTTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-2000s1c1
Sequence:CCGGCTAAGCATAAGAAAGTTCGTACTCGAGTACGAACTTTCTTATGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183146.2-3020s1c1
Sequence:CCGGCAACCACATGCAGGCTCACAACTCGAGTTGTGAGCCTGCATGTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-2731s1c1
Sequence:CCGGGCCTTCTATTATCCATCATTACTCGAGTAATGATGGATAATAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-799s1c1
Sequence:CCGGGCCTTCCATTATCCATCAATACTCGAGTATTGATGGATAATGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183146
A530054K11Rik MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-1949s1c1
Sequence:CCGGCCTATAACAGTCAAGTATGTACTCGAGTACATACTTGACTGTTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-2000s1c1
Sequence:CCGGCTAAGCATAAGAAAGTTCGTACTCGAGTACGAACTTTCTTATGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183146.2-3020s1c1
Sequence:CCGGCAACCACATGCAGGCTCACAACTCGAGTTGTGAGCCTGCATGTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-2731s1c1
Sequence:CCGGGCCTTCTATTATCCATCATTACTCGAGTAATGATGGATAATAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-799s1c1
Sequence:CCGGGCCTTCCATTATCCATCAATACTCGAGTATTGATGGATAATGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183146
A530054K11Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-1949s1c1
Sequence:CCGGCCTATAACAGTCAAGTATGTACTCGAGTACATACTTGACTGTTATAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-2000s1c1
Sequence:CCGGCTAAGCATAAGAAAGTTCGTACTCGAGTACGAACTTTCTTATGCTTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183146.2-3020s1c1
Sequence:CCGGCAACCACATGCAGGCTCACAACTCGAGTTGTGAGCCTGCATGTGGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-2731s1c1
Sequence:CCGGGCCTTCTATTATCCATCATTACTCGAGTAATGATGGATAATAGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000095232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183146.2-799s1c1
Sequence:CCGGGCCTTCCATTATCCATCAATACTCGAGTATTGATGGATAATGGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???