EMAIL THIS PAGE TO A FRIEND

A630001G21Rik

55 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074361 MISSION® esiRNA targeting mouse A630001g21rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_484889 Rosetta Predictions mouse pricing
XM_895419 Rosetta Predictions mouse pricing
XM_895429 Rosetta Predictions mouse pricing
XM_905026 Rosetta Predictions mouse pricing
XM_919139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426555 predicted 533
2 SASI_Mm01_00217656 predicted 348
3 SASI_Mm01_00217657 predicted 685
4 SASI_Mm01_00217658 predicted 628
5 SASI_Mm01_00217659 predicted 794
6 SASI_Mm01_00217660 predicted 377
7 SASI_Mm01_00217661 predicted 394
8 SASI_Mm01_00217663 predicted 384
9 SASI_Mm01_00217664 predicted 831
10 SASI_Mm02_00426556 predicted 787
11 SASI_Mm01_00217655 predicted 407
12 SASI_Mm01_00217662 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429668 predicted 627
2 SASI_Mm01_00255766 predicted 443
3 SASI_Mm01_00255767 predicted 772
4 SASI_Mm01_00255768 predicted 726
5 SASI_Mm01_00255769 predicted 894
6 SASI_Mm01_00255770 predicted 469
7 SASI_Mm01_00255771 predicted 489
8 SASI_Mm01_00255773 predicted 482
9 SASI_Mm01_00255774 predicted 922
10 SASI_Mm02_00429669 predicted 888
11 SASI_Mm01_00255765 predicted 495
12 SASI_Mm01_00255772 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245596 predicted 570
2 SASI_Mm01_00245597 predicted 834
3 SASI_Mm01_00245598 predicted 896
4 SASI_Mm01_00245599 predicted 841
5 SASI_Mm01_00245600 predicted 1004
6 SASI_Mm01_00245601 predicted 691
7 SASI_Mm01_00245602 predicted 1040
8 SASI_Mm01_00245603 predicted 939
9 SASI_Mm01_00245604 predicted 965
10 SASI_Mm01_00245605 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431408 predicted 532
2 SASI_Mm02_00431409 predicted 344
3 SASI_Mm02_00431410 predicted 681
4 SASI_Mm02_00431411 predicted 634
5 SASI_Mm02_00431412 predicted 798
6 SASI_Mm02_00431413 predicted 380
7 SASI_Mm02_00431414 predicted 397
8 SASI_Mm02_00431415 predicted 379
9 SASI_Mm02_00431416 predicted 828
10 SASI_Mm02_00431417 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442188 predicted 631
2 SASI_Mm02_00442189 predicted 445
3 SASI_Mm02_00442190 predicted 774
4 SASI_Mm02_00442191 predicted 729
5 SASI_Mm02_00442192 predicted 895
6 SASI_Mm02_00442193 predicted 469
7 SASI_Mm02_00442194 predicted 488
8 SASI_Mm02_00442195 predicted 476
9 SASI_Mm02_00442196 predicted 924
10 SASI_Mm02_00442197 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177055
A630001G21Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-370s21c1
Sequence:CCGGGTCGGACTCATCGTTTCTATGCTCGAGCATAGAAACGATGAGTCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-630s21c1
Sequence:CCGGACCAAGTGGATGAGATCATTTCTCGAGAAATGATCTCATCCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-533s21c1
Sequence:CCGGAGTTATGAGCAAGGGACAAACCTCGAGGTTTGTCCCTTGCTCATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-219s21c1
Sequence:CCGGATGCAATTACCAAGCTGTTTCCTCGAGGAAACAGCTTGGTAATTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177055.3-1214s21c1
Sequence:CCGGAGACTTTCTATCAGCTTAAATCTCGAGATTTAAGCTGATAGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177055.3-1081s21c1
Sequence:CCGGCCGGCTAACTGTCCTTGTTAACTCGAGTTAACAAGGACAGTTAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-717s21c1
Sequence:CCGGTCAGAAGGCAGATGAACAAAGCTCGAGCTTTGTTCATCTGCCTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-427s21c1
Sequence:CCGGTGCGTTAAGAGAGATTCATAACTCGAGTTATGAATCTCTCTTAACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177055
A630001G21Rik MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-370s21c1
Sequence:CCGGGTCGGACTCATCGTTTCTATGCTCGAGCATAGAAACGATGAGTCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-630s21c1
Sequence:CCGGACCAAGTGGATGAGATCATTTCTCGAGAAATGATCTCATCCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-533s21c1
Sequence:CCGGAGTTATGAGCAAGGGACAAACCTCGAGGTTTGTCCCTTGCTCATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-219s21c1
Sequence:CCGGATGCAATTACCAAGCTGTTTCCTCGAGGAAACAGCTTGGTAATTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177055.3-1214s21c1
Sequence:CCGGAGACTTTCTATCAGCTTAAATCTCGAGATTTAAGCTGATAGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177055.3-1081s21c1
Sequence:CCGGCCGGCTAACTGTCCTTGTTAACTCGAGTTAACAAGGACAGTTAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-717s21c1
Sequence:CCGGTCAGAAGGCAGATGAACAAAGCTCGAGCTTTGTTCATCTGCCTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-427s21c1
Sequence:CCGGTGCGTTAAGAGAGATTCATAACTCGAGTTATGAATCTCTCTTAACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177055
A630001G21Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-370s21c1
Sequence:CCGGGTCGGACTCATCGTTTCTATGCTCGAGCATAGAAACGATGAGTCCGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-630s21c1
Sequence:CCGGACCAAGTGGATGAGATCATTTCTCGAGAAATGATCTCATCCACTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-533s21c1
Sequence:CCGGAGTTATGAGCAAGGGACAAACCTCGAGGTTTGTCCCTTGCTCATAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-219s21c1
Sequence:CCGGATGCAATTACCAAGCTGTTTCCTCGAGGAAACAGCTTGGTAATTGCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177055.3-1214s21c1
Sequence:CCGGAGACTTTCTATCAGCTTAAATCTCGAGATTTAAGCTGATAGAAAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177055.3-1081s21c1
Sequence:CCGGCCGGCTAACTGTCCTTGTTAACTCGAGTTAACAAGGACAGTTAGCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-717s21c1
Sequence:CCGGTCAGAAGGCAGATGAACAAAGCTCGAGCTTTGTTCATCTGCCTTCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000366277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177055.3-427s21c1
Sequence:CCGGTGCGTTAAGAGAGATTCATAACTCGAGTTATGAATCTCTCTTAACGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???