EMAIL THIS PAGE TO A FRIEND

A630007B06Rik

11 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_170757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_170757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041801 MISSION® esiRNA targeting mouse Ccdc186 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187652 predicted 1750
2 SASI_Mm01_00187653 predicted 1629
3 SASI_Mm01_00187654 predicted 1147
4 SASI_Mm01_00187655 predicted 519
5 SASI_Mm01_00187656 predicted 1687
6 SASI_Mm01_00187657 predicted 1549
7 SASI_Mm01_00187658 predicted 1517
8 SASI_Mm01_00187659 predicted 2176
9 SASI_Mm01_00187660 predicted 1409
10 SASI_Mm01_00187661 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170757
VALIDATED
A630007B06Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-1945s21c1
Sequence:CCGGATGGGACAGGCTAACCGTAATCTCGAGATTACGGTTAGCCTGTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170757.1-2182s21c1
Sequence:CCGGGAGAATGGAAACCACGATAAACTCGAGTTTATCGTGGTTTCCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170757.1-1137s1c1
Sequence:CCGGGCAGCAACTCTATGAATCGAACTCGAGTTCGATTCATAGAGTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-1577s21c1
Sequence:CCGGGTCTAGAAGATGAACGCTTAACTCGAGTTAAGCGTTCATCTTCTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-2473s1c1
Sequence:CCGGCGAGAAGAATCAGGCACACTTCTCGAGAAGTGTGCCTGATTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-2161s1c1
Sequence:CCGGCGGAGAAAGTTAGAGCAGACTCTCGAGAGTCTGCTCTAACTTTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-1690s1c1
Sequence:CCGGCAGTTACATGAGCAGCTTCAACTCGAGTTGAAGCTGCTCATGTAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-2229s21c1
Sequence:CCGGGAGTTCATCAGGGTCACTTAACTCGAGTTAAGTGACCCTGATGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170757.1-1690s21c1
Sequence:CCGGCAGTTACATGAGCAGCTTCAACTCGAGTTGAAGCTGCTCATGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-520s21c1
Sequence:CCGGGTTTCAGCCTCAGACGATTTGCTCGAGCAAATCGTCTGAGGCTGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170757
VALIDATED
A630007B06Rik MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-1945s21c1
Sequence:CCGGATGGGACAGGCTAACCGTAATCTCGAGATTACGGTTAGCCTGTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170757.1-2182s21c1
Sequence:CCGGGAGAATGGAAACCACGATAAACTCGAGTTTATCGTGGTTTCCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170757.1-1137s1c1
Sequence:CCGGGCAGCAACTCTATGAATCGAACTCGAGTTCGATTCATAGAGTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-1577s21c1
Sequence:CCGGGTCTAGAAGATGAACGCTTAACTCGAGTTAAGCGTTCATCTTCTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-2473s1c1
Sequence:CCGGCGAGAAGAATCAGGCACACTTCTCGAGAAGTGTGCCTGATTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-2161s1c1
Sequence:CCGGCGGAGAAAGTTAGAGCAGACTCTCGAGAGTCTGCTCTAACTTTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-1690s1c1
Sequence:CCGGCAGTTACATGAGCAGCTTCAACTCGAGTTGAAGCTGCTCATGTAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-2229s21c1
Sequence:CCGGGAGTTCATCAGGGTCACTTAACTCGAGTTAAGTGACCCTGATGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170757.1-1690s21c1
Sequence:CCGGCAGTTACATGAGCAGCTTCAACTCGAGTTGAAGCTGCTCATGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-520s21c1
Sequence:CCGGGTTTCAGCCTCAGACGATTTGCTCGAGCAAATCGTCTGAGGCTGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170757
VALIDATED
A630007B06Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-1945s21c1
Sequence:CCGGATGGGACAGGCTAACCGTAATCTCGAGATTACGGTTAGCCTGTCCCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170757.1-2182s21c1
Sequence:CCGGGAGAATGGAAACCACGATAAACTCGAGTTTATCGTGGTTTCCATTCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000194046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170757.1-1137s1c1
Sequence:CCGGGCAGCAACTCTATGAATCGAACTCGAGTTCGATTCATAGAGTTGCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000374603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-1577s21c1
Sequence:CCGGGTCTAGAAGATGAACGCTTAACTCGAGTTAAGCGTTCATCTTCTAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000173167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-2473s1c1
Sequence:CCGGCGAGAAGAATCAGGCACACTTCTCGAGAAGTGTGCCTGATTCTTCTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000173232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-2161s1c1
Sequence:CCGGCGGAGAAAGTTAGAGCAGACTCTCGAGAGTCTGCTCTAACTTTCTCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000176310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_170757.1-1690s1c1
Sequence:CCGGCAGTTACATGAGCAGCTTCAACTCGAGTTGAAGCTGCTCATGTAACTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-2229s21c1
Sequence:CCGGGAGTTCATCAGGGTCACTTAACTCGAGTTAAGTGACCCTGATGAACTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170757.1-1690s21c1
Sequence:CCGGCAGTTACATGAGCAGCTTCAACTCGAGTTGAAGCTGCTCATGTAACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_170757.1-520s21c1
Sequence:CCGGGTTTCAGCCTCAGACGATTTGCTCGAGCAAATCGTCTGAGGCTGAAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???