EMAIL THIS PAGE TO A FRIEND

A630033H20Rik

31 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094211 MISSION® esiRNA targeting mouse P2ry10b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122595 Rosetta Predictions mouse pricing
NM_001122596 Rosetta Predictions mouse pricing
NM_175442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309037 predicted 398
2 SASI_Mm02_00309038 predicted 892
3 SASI_Mm02_00309039 predicted 1370
4 SASI_Mm02_00309040 predicted 1468
5 SASI_Mm02_00309041 predicted 1109
6 SASI_Mm02_00309042 predicted 1365
7 SASI_Mm02_00309043 predicted 1054
8 SASI_Mm02_00309044 predicted 1483
9 SASI_Mm02_00309045 predicted 1405
10 SASI_Mm02_00309046 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309047 predicted 442
2 SASI_Mm02_00309048 predicted 941
3 SASI_Mm02_00309049 predicted 1419
4 SASI_Mm02_00309050 predicted 1510
5 SASI_Mm02_00309051 predicted 1155
6 SASI_Mm02_00309052 predicted 1410
7 SASI_Mm02_00309053 predicted 1100
8 SASI_Mm02_00309054 predicted 1533
9 SASI_Mm02_00309055 predicted 1451
10 SASI_Mm02_00309056 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346329 predicted 403
2 SASI_Mm02_00346330 predicted 905
3 SASI_Mm02_00346331 predicted 1379
4 SASI_Mm02_00346332 predicted 1471
5 SASI_Mm02_00346333 predicted 1120
6 SASI_Mm02_00346334 predicted 1379
7 SASI_Mm02_00346335 predicted 1069
8 SASI_Mm02_00346336 predicted 1491
9 SASI_Mm02_00346337 predicted 1417
10 SASI_Mm02_00346338 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175442
A630033H20Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000025755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-868s1c1
Sequence:CCGGGCTTAGCCAATAACAGTGAATCTCGAGATTCACTGTTATTGGCTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-927s1c1
Sequence:CCGGGCTTCATCCATTGGCATGGTACTCGAGTACCATGCCAATGGATGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-1139s1c1
Sequence:CCGGCCCATTCTTTATGATGGTAAACTCGAGTTTACCATCATAAAGAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-1322s1c1
Sequence:CCGGCCAGTCATGTTTGCATTGTAACTCGAGTTACAATGCAAACATGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175442
A630033H20Rik MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000025755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-868s1c1
Sequence:CCGGGCTTAGCCAATAACAGTGAATCTCGAGATTCACTGTTATTGGCTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-927s1c1
Sequence:CCGGGCTTCATCCATTGGCATGGTACTCGAGTACCATGCCAATGGATGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-1139s1c1
Sequence:CCGGCCCATTCTTTATGATGGTAAACTCGAGTTTACCATCATAAAGAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-1322s1c1
Sequence:CCGGCCAGTCATGTTTGCATTGTAACTCGAGTTACAATGCAAACATGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175442
A630033H20Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000025755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-868s1c1
Sequence:CCGGGCTTAGCCAATAACAGTGAATCTCGAGATTCACTGTTATTGGCTAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-927s1c1
Sequence:CCGGGCTTCATCCATTGGCATGGTACTCGAGTACCATGCCAATGGATGAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-1139s1c1
Sequence:CCGGCCCATTCTTTATGATGGTAAACTCGAGTTTACCATCATAAAGAATGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000025766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175442.2-1322s1c1
Sequence:CCGGCCAGTCATGTTTGCATTGTAACTCGAGTTACAATGCAAACATGACTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???