EMAIL THIS PAGE TO A FRIEND

A630095E13Rik

12 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148901 MISSION® esiRNA targeting mouse Pate14 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288566 predicted 205
2 SASI_Mm01_00153668 predicted 293
3 SASI_Mm01_00153669 predicted 369
4 SASI_Mm01_00153670 predicted 306
5 SASI_Mm01_00153672 predicted 354
6 SASI_Mm01_00153673 predicted 362
7 SASI_Mm01_00153674 predicted 370
8 SASI_Mm01_00153675 predicted 283
9 SASI_Mm01_00153676 predicted 244
10 SASI_Mm01_00153677 predicted 372
11 SASI_Mm01_00153671 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033325
VALIDATED
A630095E13Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-448s21c1
Sequence:CCGGTTTAGCTCCACACCTACTTTCCTCGAGGAAAGTAGGTGTGGAGCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-210s21c1
Sequence:CCGGGCTTTACGGCTACTCTATAAACTCGAGTTTATAGAGTAGCCGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-265s21c1
Sequence:CCGGTTGGAACATGCTTCAATTATACTCGAGTATAATTGAAGCATGTTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-179s21c1
Sequence:CCGGCTCCTGTGAAGCTACAAATAACTCGAGTTATTTGTAGCTTCACAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033325.2-290s21c1
Sequence:CCGGGACCAACAATAATATGGTAAACTCGAGTTTACCATATTATTGTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033325
VALIDATED
A630095E13Rik MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-448s21c1
Sequence:CCGGTTTAGCTCCACACCTACTTTCCTCGAGGAAAGTAGGTGTGGAGCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-210s21c1
Sequence:CCGGGCTTTACGGCTACTCTATAAACTCGAGTTTATAGAGTAGCCGTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-265s21c1
Sequence:CCGGTTGGAACATGCTTCAATTATACTCGAGTATAATTGAAGCATGTTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-179s21c1
Sequence:CCGGCTCCTGTGAAGCTACAAATAACTCGAGTTATTTGTAGCTTCACAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033325.2-290s21c1
Sequence:CCGGGACCAACAATAATATGGTAAACTCGAGTTTACCATATTATTGTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033325
VALIDATED
A630095E13Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-448s21c1
Sequence:CCGGTTTAGCTCCACACCTACTTTCCTCGAGGAAAGTAGGTGTGGAGCTAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-210s21c1
Sequence:CCGGGCTTTACGGCTACTCTATAAACTCGAGTTTATAGAGTAGCCGTAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-265s21c1
Sequence:CCGGTTGGAACATGCTTCAATTATACTCGAGTATAATTGAAGCATGTTCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033325.2-179s21c1
Sequence:CCGGCTCCTGTGAAGCTACAAATAACTCGAGTTATTTGTAGCTTCACAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000268233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033325.2-290s21c1
Sequence:CCGGGACCAACAATAATATGGTAAACTCGAGTTTACCATATTATTGTTGGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???