EMAIL THIS PAGE TO A FRIEND

A730017C20Rik

12 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034081 MISSION® esiRNA targeting mouse Minar2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041374 predicted 367
2 SASI_Mm01_00041375 predicted 599
3 SASI_Mm01_00041376 predicted 361
4 SASI_Mm01_00041377 predicted 569
5 SASI_Mm01_00041378 predicted 261
6 SASI_Mm01_00041379 predicted 677
7 SASI_Mm01_00041380 predicted 617
8 SASI_Mm02_00345409 predicted 337
9 SASI_Mm01_00041381 predicted 371
10 SASI_Mm01_00041382 predicted 644
11 SASI_Mm01_00041383 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173759
A730017C20Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-489s1c1
Sequence:CCGGGAAACGCAACAAGCGATCAAACTCGAGTTTGATCGCTTGTTGCGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173759.4-786s21c1
Sequence:CCGGGCATTGTGAACGTCCGCATTGCTCGAGCAATGCGGACGTTCACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-198s1c1
Sequence:CCGGCATTGCTACTCAGCGAATCAACTCGAGTTGATTCGCTGAGTAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173759.2-1102s1c1
Sequence:CCGGCGCTTAAGTTAAAGGCGGATACTCGAGTATCCGCCTTTAACTTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-270s1c1
Sequence:CCGGGTCTTCAGTTATGAAGAACAACTCGAGTTGTTCTTCATAACTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173759.4-842s21c1
Sequence:CCGGTGTGAGCGTCGCTTGTGTTATCTCGAGATAACACAAGCGACGCTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173759
A730017C20Rik MISSION shRNA shRNA Plasmid DNA
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-489s1c1
Sequence:CCGGGAAACGCAACAAGCGATCAAACTCGAGTTTGATCGCTTGTTGCGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173759.4-786s21c1
Sequence:CCGGGCATTGTGAACGTCCGCATTGCTCGAGCAATGCGGACGTTCACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-198s1c1
Sequence:CCGGCATTGCTACTCAGCGAATCAACTCGAGTTGATTCGCTGAGTAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173759.2-1102s1c1
Sequence:CCGGCGCTTAAGTTAAAGGCGGATACTCGAGTATCCGCCTTTAACTTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-270s1c1
Sequence:CCGGGTCTTCAGTTATGAAGAACAACTCGAGTTGTTCTTCATAACTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173759.4-842s21c1
Sequence:CCGGTGTGAGCGTCGCTTGTGTTATCTCGAGATAACACAAGCGACGCTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173759
A730017C20Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-489s1c1
Sequence:CCGGGAAACGCAACAAGCGATCAAACTCGAGTTTGATCGCTTGTTGCGTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000446205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173759.4-786s21c1
Sequence:CCGGGCATTGTGAACGTCCGCATTGCTCGAGCAATGCGGACGTTCACAATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-198s1c1
Sequence:CCGGCATTGCTACTCAGCGAATCAACTCGAGTTGATTCGCTGAGTAGCAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173759.2-1102s1c1
Sequence:CCGGCGCTTAAGTTAAAGGCGGATACTCGAGTATCCGCCTTTAACTTAAGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000193534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173759.2-270s1c1
Sequence:CCGGGTCTTCAGTTATGAAGAACAACTCGAGTTGTTCTTCATAACTGAAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000442767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173759.4-842s21c1
Sequence:CCGGTGTGAGCGTCGCTTGTGTTATCTCGAGATAACACAAGCGACGCTCACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???