EMAIL THIS PAGE TO A FRIEND

A830018L16Rik

12 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU200011 MISSION® esiRNA targeting mouse A830018l16rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198154 predicted 1776
2 SASI_Mm01_00198155 predicted 1850
3 SASI_Mm01_00198156 predicted 1492
4 SASI_Mm01_00198157 predicted 1864
5 SASI_Mm01_00198158 predicted 942
6 SASI_Mm01_00198159 predicted 580
7 SASI_Mm02_00347168 predicted 1264
8 SASI_Mm01_00198160 predicted 1511
9 SASI_Mm01_00198162 predicted 844
10 SASI_Mm01_00198163 predicted 1626
11 SASI_Mm01_00198161 predicted 1715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177173
A830018L16Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-1333s21c1
Sequence:CCGGTGTAACCACTCTGGTACTTTCCTCGAGGAAAGTACCAGAGTGGTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177173.5-1859s21c1
Sequence:CCGGCCTTACTTATTGTCCTAATTTCTCGAGAAATTAGGACAATAAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-831s21c1
Sequence:CCGGAGTGGAACTGGCGGACTAAACCTCGAGGTTTAGTCCGCCAGTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-758s21c1
Sequence:CCGGGATCTGGCTGTATCTAATATTCTCGAGAATATTAGATACAGCCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-920s21c1
Sequence:CCGGGAGAATCTCTCTCGAAGTATCCTCGAGGATACTTCGAGAGAGATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-849s21c1
Sequence:CCGGTAAACCACAAAGCCGTGATTTCTCGAGAAATCACGGCTTTGTGGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-759s21c1
Sequence:CCGGTGATCTGGCTGTATCTAATATCTCGAGATATTAGATACAGCCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-930s21c1
Sequence:CCGGCTCTCGAAGTATCGCGATTTCCTCGAGGAAATCGCGATACTTCGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-1772s21c1
Sequence:CCGGCCTGTCCTACCCTGATCTATTCTCGAGAATAGATCAGGGTAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177173
A830018L16Rik MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-1333s21c1
Sequence:CCGGTGTAACCACTCTGGTACTTTCCTCGAGGAAAGTACCAGAGTGGTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177173.5-1859s21c1
Sequence:CCGGCCTTACTTATTGTCCTAATTTCTCGAGAAATTAGGACAATAAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-831s21c1
Sequence:CCGGAGTGGAACTGGCGGACTAAACCTCGAGGTTTAGTCCGCCAGTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-758s21c1
Sequence:CCGGGATCTGGCTGTATCTAATATTCTCGAGAATATTAGATACAGCCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-920s21c1
Sequence:CCGGGAGAATCTCTCTCGAAGTATCCTCGAGGATACTTCGAGAGAGATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-849s21c1
Sequence:CCGGTAAACCACAAAGCCGTGATTTCTCGAGAAATCACGGCTTTGTGGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-759s21c1
Sequence:CCGGTGATCTGGCTGTATCTAATATCTCGAGATATTAGATACAGCCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-930s21c1
Sequence:CCGGCTCTCGAAGTATCGCGATTTCCTCGAGGAAATCGCGATACTTCGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-1772s21c1
Sequence:CCGGCCTGTCCTACCCTGATCTATTCTCGAGAATAGATCAGGGTAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177173
A830018L16Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-1333s21c1
Sequence:CCGGTGTAACCACTCTGGTACTTTCCTCGAGGAAAGTACCAGAGTGGTTACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177173.5-1859s21c1
Sequence:CCGGCCTTACTTATTGTCCTAATTTCTCGAGAAATTAGGACAATAAGTAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000353263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-831s21c1
Sequence:CCGGAGTGGAACTGGCGGACTAAACCTCGAGGTTTAGTCCGCCAGTTCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-758s21c1
Sequence:CCGGGATCTGGCTGTATCTAATATTCTCGAGAATATTAGATACAGCCAGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000345844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.5-920s21c1
Sequence:CCGGGAGAATCTCTCTCGAAGTATCCTCGAGGATACTTCGAGAGAGATTCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-849s21c1
Sequence:CCGGTAAACCACAAAGCCGTGATTTCTCGAGAAATCACGGCTTTGTGGTTTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-759s21c1
Sequence:CCGGTGATCTGGCTGTATCTAATATCTCGAGATATTAGATACAGCCAGATCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-930s21c1
Sequence:CCGGCTCTCGAAGTATCGCGATTTCCTCGAGGAAATCGCGATACTTCGAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177173.4-1772s21c1
Sequence:CCGGCCTGTCCTACCCTGATCTATTCTCGAGAATAGATCAGGGTAGGACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???