EMAIL THIS PAGE TO A FRIEND

A830080D01Rik

13 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU150341 MISSION® esiRNA targeting mouse Bclaf3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031083 predicted 1439
2 SASI_Mm01_00031084 predicted 1329
3 SASI_Mm01_00031085 predicted 1543
4 SASI_Mm01_00031086 predicted 1758
5 SASI_Mm01_00031087 predicted 734
6 SASI_Mm01_00031088 predicted 1708
7 SASI_Mm01_00031089 predicted 327
8 SASI_Mm02_00288823 predicted 1214
9 SASI_Mm01_00031091 predicted 1201
10 SASI_Mm02_00288824 predicted 2024
11 SASI_Mm01_00031090 predicted 506
12 SASI_Mm01_00031092 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033472
VALIDATED
A830080D01Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033472.1-1610s1c1
Sequence:CCGGGCTCAGGAAATCATAACACTACTCGAGTAGTGTTATGATTTCCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033472.1-290s1c1
Sequence:CCGGCCCTTTACTTGGAGAATGGATCTCGAGATCCATTCTCCAAGTAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033472.1-2241s1c1
Sequence:CCGGGCCAACCCTATATGAAGACTTCTCGAGAAGTCTTCATATAGGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033472.1-2206s1c1
Sequence:CCGGCCAAGGACAAACAACCTGGAACTCGAGTTCCAGGTTGTTTGTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033472
VALIDATED
A830080D01Rik MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033472.1-1610s1c1
Sequence:CCGGGCTCAGGAAATCATAACACTACTCGAGTAGTGTTATGATTTCCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033472.1-290s1c1
Sequence:CCGGCCCTTTACTTGGAGAATGGATCTCGAGATCCATTCTCCAAGTAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033472.1-2241s1c1
Sequence:CCGGGCCAACCCTATATGAAGACTTCTCGAGAAGTCTTCATATAGGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033472.1-2206s1c1
Sequence:CCGGCCAAGGACAAACAACCTGGAACTCGAGTTCCAGGTTGTTTGTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033472
VALIDATED
A830080D01Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033472.1-1610s1c1
Sequence:CCGGGCTCAGGAAATCATAACACTACTCGAGTAGTGTTATGATTTCCTGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000180161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033472.1-290s1c1
Sequence:CCGGCCCTTTACTTGGAGAATGGATCTCGAGATCCATTCTCCAAGTAAAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000180905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033472.1-2241s1c1
Sequence:CCGGGCCAACCCTATATGAAGACTTCTCGAGAAGTCTTCATATAGGGTTGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033472.1-2206s1c1
Sequence:CCGGCCAAGGACAAACAACCTGGAACTCGAGTTCCAGGTTGTTTGTCCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???