EMAIL THIS PAGE TO A FRIEND

A930018P22Rik

11 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074991 MISSION® esiRNA targeting mouse A930018p22rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_026634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120220 predicted 592
2 SASI_Mm01_00120221 predicted 537
3 SASI_Mm01_00120222 predicted 545
4 SASI_Mm01_00120223 predicted 540
5 SASI_Mm01_00120224 predicted 538
6 SASI_Mm01_00120225 predicted 339
7 SASI_Mm01_00120226 predicted 340
8 SASI_Mm01_00120227 predicted 484
9 SASI_Mm01_00120228 predicted 485
10 SASI_Mm01_00120229 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026634
A930018P22Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000266909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-122s21c1
Sequence:CCGGCCTCTACTTTCCGTCGCTCTACTCGAGTAGAGCGACGGAAAGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-549s1c1
Sequence:CCGGCGACTCCCAGCGCTATAAATTCTCGAGAATTTATAGCGCTGGGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-158s21c1
Sequence:CCGGGTCGTCTCCGCTGAGCGATTTCTCGAGAAATCGCTCAGCGGAGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-546s21c1
Sequence:CCGGTTCGACTCCCAGCGCTATAAACTCGAGTTTATAGCGCTGGGAGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-490s21c1
Sequence:CCGGGCGAGCTAGAGATCCGGATTACTCGAGTAATCCGGATCTCTAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-183s1c1
Sequence:CCGGCATCTGGAAGAAGCTCTTCGTCTCGAGACGAAGAGCTTCTTCCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-495s1c1
Sequence:CCGGGCTAGAGATCCGGATTAAGGACTCGAGTCCTTAATCCGGATCTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-517s21c1
Sequence:CCGGTGGAGCTGCTCACAATCACTGCTCGAGCAGTGATTGTGAGCAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026634
A930018P22Rik MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000266909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-122s21c1
Sequence:CCGGCCTCTACTTTCCGTCGCTCTACTCGAGTAGAGCGACGGAAAGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-549s1c1
Sequence:CCGGCGACTCCCAGCGCTATAAATTCTCGAGAATTTATAGCGCTGGGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-158s21c1
Sequence:CCGGGTCGTCTCCGCTGAGCGATTTCTCGAGAAATCGCTCAGCGGAGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-546s21c1
Sequence:CCGGTTCGACTCCCAGCGCTATAAACTCGAGTTTATAGCGCTGGGAGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-490s21c1
Sequence:CCGGGCGAGCTAGAGATCCGGATTACTCGAGTAATCCGGATCTCTAGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-183s1c1
Sequence:CCGGCATCTGGAAGAAGCTCTTCGTCTCGAGACGAAGAGCTTCTTCCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-495s1c1
Sequence:CCGGGCTAGAGATCCGGATTAAGGACTCGAGTCCTTAATCCGGATCTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-517s21c1
Sequence:CCGGTGGAGCTGCTCACAATCACTGCTCGAGCAGTGATTGTGAGCAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026634
A930018P22Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000266909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-122s21c1
Sequence:CCGGCCTCTACTTTCCGTCGCTCTACTCGAGTAGAGCGACGGAAAGTAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-549s1c1
Sequence:CCGGCGACTCCCAGCGCTATAAATTCTCGAGAATTTATAGCGCTGGGAGTCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-158s21c1
Sequence:CCGGGTCGTCTCCGCTGAGCGATTTCTCGAGAAATCGCTCAGCGGAGACGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-546s21c1
Sequence:CCGGTTCGACTCCCAGCGCTATAAACTCGAGTTTATAGCGCTGGGAGTCGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-490s21c1
Sequence:CCGGGCGAGCTAGAGATCCGGATTACTCGAGTAATCCGGATCTCTAGCTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-183s1c1
Sequence:CCGGCATCTGGAAGAAGCTCTTCGTCTCGAGACGAAGAGCTTCTTCCAGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026634.1-495s1c1
Sequence:CCGGGCTAGAGATCCGGATTAAGGACTCGAGTCCTTAATCCGGATCTCTAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000266911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026634.2-517s21c1
Sequence:CCGGTGGAGCTGCTCACAATCACTGCTCGAGCAGTGATTGTGAGCAGCTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???