EMAIL THIS PAGE TO A FRIEND

AA467197

11 Gene Product Result for
Species: Mouse AA467197(433470)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU045441 MISSION® esiRNA targeting mouse Aa467197 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111710 predicted 339
2 SASI_Mm01_00111711 predicted 307
3 SASI_Mm01_00111712 predicted 356
4 SASI_Mm01_00111713 predicted 282
5 SASI_Mm01_00111714 predicted 290
6 SASI_Mm01_00111715 predicted 412
7 SASI_Mm01_00111716 predicted 323
8 SASI_Mm01_00111717 predicted 407
9 SASI_Mm01_00111718 predicted 303
10 SASI_Mm01_00111719 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004174
AA467197 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-264s1c1
Sequence:CCGGGCTTATAACCATCAACCAGCACTCGAGTGCTGGTTGATGGTTATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-265s1c1
Sequence:CCGGCTTATAACCATCAACCAGCAACTCGAGTTGCTGGTTGATGGTTATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-167s1c1
Sequence:CCGGCTTTCGCTTTGTATGCGTTGACTCGAGTCAACGCATACAAAGCGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-115s1c1
Sequence:CCGGGAACTCATTCCTTTGGCGTTTCTCGAGAAACGCCAAAGGAATGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-196s1c1
Sequence:CCGGGACGTGGTTATTGATCGGAAACTCGAGTTTCCGATCAATAACCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004174
AA467197 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-264s1c1
Sequence:CCGGGCTTATAACCATCAACCAGCACTCGAGTGCTGGTTGATGGTTATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-265s1c1
Sequence:CCGGCTTATAACCATCAACCAGCAACTCGAGTTGCTGGTTGATGGTTATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-167s1c1
Sequence:CCGGCTTTCGCTTTGTATGCGTTGACTCGAGTCAACGCATACAAAGCGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-115s1c1
Sequence:CCGGGAACTCATTCCTTTGGCGTTTCTCGAGAAACGCCAAAGGAATGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-196s1c1
Sequence:CCGGGACGTGGTTATTGATCGGAAACTCGAGTTTCCGATCAATAACCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004174
AA467197 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-264s1c1
Sequence:CCGGGCTTATAACCATCAACCAGCACTCGAGTGCTGGTTGATGGTTATAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-265s1c1
Sequence:CCGGCTTATAACCATCAACCAGCAACTCGAGTTGCTGGTTGATGGTTATAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-167s1c1
Sequence:CCGGCTTTCGCTTTGTATGCGTTGACTCGAGTCAACGCATACAAAGCGAAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-115s1c1
Sequence:CCGGGAACTCATTCCTTTGGCGTTTCTCGAGAAACGCCAAAGGAATGAGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004174.1-196s1c1
Sequence:CCGGGACGTGGTTATTGATCGGAAACTCGAGTTTCCGATCAATAACCACGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???