EMAIL THIS PAGE TO A FRIEND

AA986860

19 Gene Product Result for
Species: Mouse AA986860(212439)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU054431 MISSION® esiRNA targeting mouse Aa986860 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155537 predicted 1243
2 SASI_Mm02_00347801 predicted 895
3 SASI_Mm01_00155545 predicted 1157
4 SASI_Mm02_00347802 predicted 1763
5 SASI_Mm02_00347803 predicted 941
6 SASI_Mm02_00347804 predicted 2021
7 SASI_Mm02_00347805 predicted 793
8 SASI_Mm02_00347806 predicted 850
9 SASI_Mm02_00347807 predicted 2057
10 SASI_Mm02_00347808 predicted 797
11 SASI_Mm01_00155538 predicted 1728
12 SASI_Mm01_00155539 predicted 2274
13 SASI_Mm01_00155540 predicted 2891
14 SASI_Mm01_00155541 predicted 1725
15 SASI_Mm01_00155542 predicted 1608
16 SASI_Mm01_00155543 predicted 1540
17 SASI_Mm01_00155544 predicted 1538
18 SASI_Mm01_00155546 predicted 1717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177604
AA986860 MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-1419s1c1
Sequence:CCGGGATCCCAGTCTGCTTGTAAATCTCGAGATTTACAAGCAGACTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-1072s1c1
Sequence:CCGGCTGAAACCGTATCCCATAAAGCTCGAGCTTTATGGGATACGGTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-1961s1c1
Sequence:CCGGCATTCCTATCCCTAAGACCTTCTCGAGAAGGTCTTAGGGATAGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-2237s1c1
Sequence:CCGGCTTGGGCATGGGAAAGGATTTCTCGAGAAATCCTTTCCCATGCCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2902s1c1
Sequence:CCGGGCTGAGTTTCTGCAGTAACTTCTCGAGAAGTTACTGCAGAAACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-2023s1c1
Sequence:CCGGCCTTCAAAGGACAGAGTTATGCTCGAGCATAACTCTGTCCTTTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2682s1c1
Sequence:CCGGCTTACATATCACTGACACTATCTCGAGATAGTGTCAGTGATATGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-2359s1c1
Sequence:CCGGCCTGTATCAGTGTCAAGATATCTCGAGATATCTTGACACTGATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2889s1c1
Sequence:CCGGGCATGAAATACAGGCTGAGTTCTCGAGAACTCAGCCTGTATTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177604
AA986860 MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-1419s1c1
Sequence:CCGGGATCCCAGTCTGCTTGTAAATCTCGAGATTTACAAGCAGACTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-1072s1c1
Sequence:CCGGCTGAAACCGTATCCCATAAAGCTCGAGCTTTATGGGATACGGTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-1961s1c1
Sequence:CCGGCATTCCTATCCCTAAGACCTTCTCGAGAAGGTCTTAGGGATAGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-2237s1c1
Sequence:CCGGCTTGGGCATGGGAAAGGATTTCTCGAGAAATCCTTTCCCATGCCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2902s1c1
Sequence:CCGGGCTGAGTTTCTGCAGTAACTTCTCGAGAAGTTACTGCAGAAACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-2023s1c1
Sequence:CCGGCCTTCAAAGGACAGAGTTATGCTCGAGCATAACTCTGTCCTTTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2682s1c1
Sequence:CCGGCTTACATATCACTGACACTATCTCGAGATAGTGTCAGTGATATGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-2359s1c1
Sequence:CCGGCCTGTATCAGTGTCAAGATATCTCGAGATATCTTGACACTGATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2889s1c1
Sequence:CCGGGCATGAAATACAGGCTGAGTTCTCGAGAACTCAGCCTGTATTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177604
AA986860 MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-1419s1c1
Sequence:CCGGGATCCCAGTCTGCTTGTAAATCTCGAGATTTACAAGCAGACTGGGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-1072s1c1
Sequence:CCGGCTGAAACCGTATCCCATAAAGCTCGAGCTTTATGGGATACGGTTTCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-1961s1c1
Sequence:CCGGCATTCCTATCCCTAAGACCTTCTCGAGAAGGTCTTAGGGATAGGAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000173452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-2237s1c1
Sequence:CCGGCTTGGGCATGGGAAAGGATTTCTCGAGAAATCCTTTCCCATGCCCAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2902s1c1
Sequence:CCGGGCTGAGTTTCTGCAGTAACTTCTCGAGAAGTTACTGCAGAAACTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.3-2023s1c1
Sequence:CCGGCCTTCAAAGGACAGAGTTATGCTCGAGCATAACTCTGTCCTTTGAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2682s1c1
Sequence:CCGGCTTACATATCACTGACACTATCTCGAGATAGTGTCAGTGATATGTAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177604.2-2359s1c1
Sequence:CCGGCCTGTATCAGTGTCAAGATATCTCGAGATATCTTGACACTGATACAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177604.2-2889s1c1
Sequence:CCGGGCATGAAATACAGGCTGAGTTCTCGAGAACTCAGCCTGTATTTCATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???