EMAIL THIS PAGE TO A FRIEND

AARS

alanyl-tRNA synthetase

88 Gene Product Result for
Synonyms: CMT2N
UniProtKB ID: P49588, A6NF14, Q53GV7, Q96FA0
Gene ID:
Human(16) Summary: The human alanyl-tRNA synthetase (AARS) belongs to a family of tRNA synthases, of the class II enzymes. Class II tRNA synthases evolved early in evolution and are highly conserved. This is reflected by the fact that 498 of the 968-residue polypeptide human AARS shares 41% identity witht the E.coli protein. tRNA synthases are the enzymes that interpret the RNA code and attach specific aminoacids to the tRNAs that contain the cognate trinucleotide anticodons. They consist of a catalytic domain which interacts with the amino acid acceptor-T psi C helix of the tRNA, and a second domain which interacts with the rest of the tRNA structure. [provided by RefSeq, Jul 2008]
Mouse(234734) alanyl-tRNA synthetase
Rat(292023) alanyl-tRNA synthetase
naked mole-rat(101717838) alanyl-tRNA synthetase
domestic guinea pig(100717660) alanyl-tRNA synthetase
sheep(101114460) alanyl-tRNA synthetase
Domestic Rabbit(100348310) alanyl-tRNA synthetase
Zebrafish(324940) alanyl-tRNA synthetase
Horse(100054983) alanyl-tRNA synthetase
chicken(415668) alanyl-tRNA synthetase
cow(510933) alanyl-tRNA synthetase
domestic cat(101088636) alanyl-tRNA synthetase
dog(479656) alanyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001605 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048881 MISSION® esiRNA esiRNA human AARS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001605 Rosetta Predictions human pricing
XM_001077503 Rosetta Predictions rat pricing
XM_214690 Rosetta Predictions rat pricing
NM_146217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012342 predicted 494
2 SASI_Hs01_00012343 predicted 756
3 SASI_Hs01_00012344 predicted 1591
4 SASI_Hs02_00332156 predicted 2676
5 SASI_Hs01_00012347 predicted 869
6 SASI_Hs02_00332157 predicted 1838
7 SASI_Hs01_00012348 predicted 1069
8 SASI_Hs01_00012349 predicted 2627
9 SASI_Hs01_00012350 predicted 1181
10 SASI_Hs02_00332158 predicted 1424
11 SASI_Hs01_00012341 predicted 1441
12 SASI_Hs01_00012345 predicted 2160
13 SASI_Hs01_00012346 predicted 2071
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357315 predicted 1695
2 SASI_Rn02_00357316 predicted 2713
3 SASI_Rn02_00357317 predicted 2574
4 SASI_Rn02_00357318 predicted 1259
5 SASI_Rn02_00357319 predicted 438
6 SASI_Rn02_00357320 predicted 1499
7 SASI_Rn02_00357321 predicted 425
8 SASI_Rn02_00357322 predicted 848
9 SASI_Rn02_00357323 predicted 1360
10 SASI_Rn02_00357324 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375515 predicted 1691
2 SASI_Rn02_00375516 predicted 2709
3 SASI_Rn02_00375517 predicted 2576
4 SASI_Rn02_00375518 predicted 1261
5 SASI_Rn02_00375519 predicted 439
6 SASI_Rn02_00375520 predicted 1499
7 SASI_Rn02_00375521 predicted 429
8 SASI_Rn02_00375522 predicted 841
9 SASI_Rn02_00375523 predicted 1358
10 SASI_Rn02_00375524 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341917 predicted 2925
2 SASI_Mm01_00033620 predicted 718
3 SASI_Mm01_00033621 predicted 1947
4 SASI_Mm01_00033622 predicted 688
5 SASI_Mm01_00033625 predicted 2287
6 SASI_Mm02_00341918 predicted 1628
7 SASI_Mm01_00033626 predicted 332
8 SASI_Mm01_00033627 predicted 2783
9 SASI_Mm01_00033628 predicted 486
10 SASI_Mm01_00033629 predicted 2472
11 SASI_Mm01_00033623 predicted 2046
12 SASI_Mm01_00033624 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146217
AARS MISSION shRNA Bacterial Glycerol Stock
alanyl-tRNA synthetase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-2037s21c1
Sequence:CCGGGCTGCACATAGGAACGATATACTCGAGTATATCGTTCCTATGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-966s21c1
Sequence:CCGGCCTCGTGTTCATCCAGTATAACTCGAGTTATACTGGATGAACACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-2835s21c1
Sequence:CCGGGCGAGTGTTAGAGAAGACAAACTCGAGTTTGTCTTCTCTAACACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-1699s21c1
Sequence:CCGGGACCTCATCATGCTGGACATTCTCGAGAATGTCCAGCATGATGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146217.3-3993s1c1
Sequence:CCGGGCAGAGATACTGTCTGCTTATCTCGAGATAAGCAGACAGTATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-2835s1c1
Sequence:CCGGGCGAGTGTTAGAGAAGACAAACTCGAGTTTGTCTTCTCTAACACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-1699s1c1
Sequence:CCGGGACCTCATCATGCTGGACATTCTCGAGAATGTCCAGCATGATGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-2037s1c1
Sequence:CCGGGCTGCACATAGGAACGATATACTCGAGTATATCGTTCCTATGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-966s1c1
Sequence:CCGGCCTCGTGTTCATCCAGTATAACTCGAGTTATACTGGATGAACACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146217
AARS MISSION shRNA shRNA Plasmid DNA
alanyl-tRNA synthetase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-2037s21c1
Sequence:CCGGGCTGCACATAGGAACGATATACTCGAGTATATCGTTCCTATGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-966s21c1
Sequence:CCGGCCTCGTGTTCATCCAGTATAACTCGAGTTATACTGGATGAACACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-2835s21c1
Sequence:CCGGGCGAGTGTTAGAGAAGACAAACTCGAGTTTGTCTTCTCTAACACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-1699s21c1
Sequence:CCGGGACCTCATCATGCTGGACATTCTCGAGAATGTCCAGCATGATGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146217.3-3993s1c1
Sequence:CCGGGCAGAGATACTGTCTGCTTATCTCGAGATAAGCAGACAGTATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-2835s1c1
Sequence:CCGGGCGAGTGTTAGAGAAGACAAACTCGAGTTTGTCTTCTCTAACACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-1699s1c1
Sequence:CCGGGACCTCATCATGCTGGACATTCTCGAGAATGTCCAGCATGATGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-2037s1c1
Sequence:CCGGGCTGCACATAGGAACGATATACTCGAGTATATCGTTCCTATGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-966s1c1
Sequence:CCGGCCTCGTGTTCATCCAGTATAACTCGAGTTATACTGGATGAACACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146217
AARS MISSION shRNA Lentiviral Transduction Particles
alanyl-tRNA synthetase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-2037s21c1
Sequence:CCGGGCTGCACATAGGAACGATATACTCGAGTATATCGTTCCTATGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-966s21c1
Sequence:CCGGCCTCGTGTTCATCCAGTATAACTCGAGTTATACTGGATGAACACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-2835s21c1
Sequence:CCGGGCGAGTGTTAGAGAAGACAAACTCGAGTTTGTCTTCTCTAACACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146217.3-1699s21c1
Sequence:CCGGGACCTCATCATGCTGGACATTCTCGAGAATGTCCAGCATGATGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146217.3-3993s1c1
Sequence:CCGGGCAGAGATACTGTCTGCTTATCTCGAGATAAGCAGACAGTATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-2835s1c1
Sequence:CCGGGCGAGTGTTAGAGAAGACAAACTCGAGTTTGTCTTCTCTAACACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-1699s1c1
Sequence:CCGGGACCTCATCATGCTGGACATTCTCGAGAATGTCCAGCATGATGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-2037s1c1
Sequence:CCGGGCTGCACATAGGAACGATATACTCGAGTATATCGTTCCTATGTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146217.3-966s1c1
Sequence:CCGGCCTCGTGTTCATCCAGTATAACTCGAGTTATACTGGATGAACACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001605
VALIDATED
AARS MISSION shRNA Bacterial Glycerol Stock
alanyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-720s21c1
Sequence:CCGGGTCAACCAGGACGACCCTAATCTCGAGATTAGGGTCGTCCTGGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-1216s21c1
Sequence:CCGGACATGGTGAAGGACATCATTACTCGAGTAATGATGTCCTTCACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001605.2-863s21c1
Sequence:CCGGGCAGAATAAGATGTCCAACTACTCGAGTAGTTGGACATCTTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-2615s21c1
Sequence:CCGGCGATGTCCAGAAACGAGTGTTCTCGAGAACACTCGTTTCTGGACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001605.2-3069s21c1
Sequence:CCGGTCATCTGCTACAAGAACATTTCTCGAGAAATGTTCTTGTAGCAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-611s1c1
Sequence:CCGGCCCAGGCAACATGAAGGATAACTCGAGTTATCCTTCATGTTGCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001605.1-863s1c1
Sequence:CCGGGCAGAATAAGATGTCCAACTACTCGAGTAGTTGGACATCTTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-143s1c1
Sequence:CCGGGCAGCGATTTATAGATTTCTTCTCGAGAAGAAATCTATAAATCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001605.1-2615s1c1
Sequence:CCGGCGATGTCCAGAAACGAGTGTTCTCGAGAACACTCGTTTCTGGACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-1491s1c1
Sequence:CCGGGACCTCATTATGCTGGACATTCTCGAGAATGTCCAGCATAATGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001605
VALIDATED
AARS MISSION shRNA shRNA Plasmid DNA
alanyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-720s21c1
Sequence:CCGGGTCAACCAGGACGACCCTAATCTCGAGATTAGGGTCGTCCTGGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-1216s21c1
Sequence:CCGGACATGGTGAAGGACATCATTACTCGAGTAATGATGTCCTTCACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001605.2-863s21c1
Sequence:CCGGGCAGAATAAGATGTCCAACTACTCGAGTAGTTGGACATCTTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-2615s21c1
Sequence:CCGGCGATGTCCAGAAACGAGTGTTCTCGAGAACACTCGTTTCTGGACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001605.2-3069s21c1
Sequence:CCGGTCATCTGCTACAAGAACATTTCTCGAGAAATGTTCTTGTAGCAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-611s1c1
Sequence:CCGGCCCAGGCAACATGAAGGATAACTCGAGTTATCCTTCATGTTGCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001605.1-863s1c1
Sequence:CCGGGCAGAATAAGATGTCCAACTACTCGAGTAGTTGGACATCTTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-143s1c1
Sequence:CCGGGCAGCGATTTATAGATTTCTTCTCGAGAAGAAATCTATAAATCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001605.1-2615s1c1
Sequence:CCGGCGATGTCCAGAAACGAGTGTTCTCGAGAACACTCGTTTCTGGACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-1491s1c1
Sequence:CCGGGACCTCATTATGCTGGACATTCTCGAGAATGTCCAGCATAATGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001605
VALIDATED
AARS MISSION shRNA Lentiviral Transduction Particles
alanyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-720s21c1
Sequence:CCGGGTCAACCAGGACGACCCTAATCTCGAGATTAGGGTCGTCCTGGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-1216s21c1
Sequence:CCGGACATGGTGAAGGACATCATTACTCGAGTAATGATGTCCTTCACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001605.2-863s21c1
Sequence:CCGGGCAGAATAAGATGTCCAACTACTCGAGTAGTTGGACATCTTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001605.2-2615s21c1
Sequence:CCGGCGATGTCCAGAAACGAGTGTTCTCGAGAACACTCGTTTCTGGACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001605.2-3069s21c1
Sequence:CCGGTCATCTGCTACAAGAACATTTCTCGAGAAATGTTCTTGTAGCAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-611s1c1
Sequence:CCGGCCCAGGCAACATGAAGGATAACTCGAGTTATCCTTCATGTTGCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001605.1-863s1c1
Sequence:CCGGGCAGAATAAGATGTCCAACTACTCGAGTAGTTGGACATCTTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-143s1c1
Sequence:CCGGGCAGCGATTTATAGATTTCTTCTCGAGAAGAAATCTATAAATCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001605.1-2615s1c1
Sequence:CCGGCGATGTCCAGAAACGAGTGTTCTCGAGAACACTCGTTTCTGGACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001605.1-1491s1c1
Sequence:CCGGGACCTCATTATGCTGGACATTCTCGAGAATGTCCAGCATAATGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)