EMAIL THIS PAGE TO A FRIEND

Abca17

38 Gene Product Result for
Gene ID:
Rat(287112) ATP-binding cassette, subfamily A (ABC1), member 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001031621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001031621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU188311 MISSION® esiRNA targeting mouse Abca17 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031637 Rosetta Predictions rat pricing
XM_001057541 Rosetta Predictions rat pricing
NM_001031621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077258 predicted 3239
2 SASI_Rn02_00203567 predicted 3662
3 SASI_Rn01_00077260 predicted 1608
4 SASI_Rn01_00077261 predicted 218
5 SASI_Rn01_00077262 predicted 2236
6 SASI_Rn01_00077263 predicted 2394
7 SASI_Rn01_00077264 predicted 624
8 SASI_Rn01_00077265 predicted 4887
9 SASI_Rn01_00077267 predicted 2471
10 SASI_Rn02_00203568 predicted 256
11 SASI_Rn01_00077259 predicted 3805
12 SASI_Rn01_00077266 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286726 predicted 3395
2 SASI_Rn02_00286727 predicted 3951
3 SASI_Rn02_00286728 predicted 1760
4 SASI_Rn02_00286729 predicted 1799
5 SASI_Rn02_00286730 predicted 2392
6 SASI_Rn02_00286731 predicted 2545
7 SASI_Rn02_00286732 predicted 796
8 SASI_Rn02_00286733 predicted 5042
9 SASI_Rn02_00286734 predicted 2620
10 SASI_Rn02_00286735 predicted 4260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061486 predicted 2743
2 SASI_Mm02_00288148 predicted 4758
3 SASI_Mm01_00061488 predicted 3763
4 SASI_Mm02_00288149 predicted 3777
5 SASI_Mm02_00288150 predicted 4503
6 SASI_Mm02_00288151 predicted 3316
7 SASI_Mm02_00288152 predicted 3327
8 SASI_Mm01_00061490 predicted 1552
9 SASI_Mm01_00061492 predicted 1445
10 SASI_Mm01_00061493 predicted 379
11 SASI_Mm01_00061487 predicted 3881
12 SASI_Mm01_00061489 predicted 942
13 SASI_Mm01_00061491 predicted 4054
14 SASI_Mm01_00061494 predicted 521
15 SASI_Mm01_00061495 predicted 4059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031621
Abca17 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-4062s21c1
Sequence:CCGGGCGTTATTTGGAAACGTTAGTCTCGAGACTAACGTTTCCAAATAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1697s21c1
Sequence:CCGGCTGTTCTGACAGGTCTCATTACTCGAGTAATGAGACCTGTCAGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1796s21c1
Sequence:CCGGGGTGCCCACAGCATGACATTTCTCGAGAAATGTCATGCTGTGGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-4050s21c1
Sequence:CCGGGGAAACCATCAAGCGTTATTTCTCGAGAAATAACGCTTGATGGTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1833s21c1
Sequence:CCGGAGTAACTGACCACCTTTATTTCTCGAGAAATAAAGGTGGTCAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031621
Abca17 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-4062s21c1
Sequence:CCGGGCGTTATTTGGAAACGTTAGTCTCGAGACTAACGTTTCCAAATAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1697s21c1
Sequence:CCGGCTGTTCTGACAGGTCTCATTACTCGAGTAATGAGACCTGTCAGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1796s21c1
Sequence:CCGGGGTGCCCACAGCATGACATTTCTCGAGAAATGTCATGCTGTGGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-4050s21c1
Sequence:CCGGGGAAACCATCAAGCGTTATTTCTCGAGAAATAACGCTTGATGGTTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1833s21c1
Sequence:CCGGAGTAACTGACCACCTTTATTTCTCGAGAAATAAAGGTGGTCAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031621
Abca17 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-4062s21c1
Sequence:CCGGGCGTTATTTGGAAACGTTAGTCTCGAGACTAACGTTTCCAAATAACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1697s21c1
Sequence:CCGGCTGTTCTGACAGGTCTCATTACTCGAGTAATGAGACCTGTCAGAACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1796s21c1
Sequence:CCGGGGTGCCCACAGCATGACATTTCTCGAGAAATGTCATGCTGTGGGCACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-4050s21c1
Sequence:CCGGGGAAACCATCAAGCGTTATTTCTCGAGAAATAACGCTTGATGGTTTCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000251586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031621.2-1833s21c1
Sequence:CCGGAGTAACTGACCACCTTTATTTCTCGAGAAATAAAGGTGGTCAGTTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???