EMAIL THIS PAGE TO A FRIEND

ABCA7

ATP-binding cassette, sub-family A (ABC1), member 7

60 Gene Product Result for
Synonyms: ABCA-SSN ABCX
UniProtKB ID: Q8IZY2, Q96S58, Q9BZC4, Q9NR73, Q9UKP8
Gene ID:
Human(10347) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This full transporter has been detected predominantly in myelo-lymphatic tissues with the highest expression in peripheral leukocytes, thymus, spleen, and bone marrow. The function of this protein is not yet known; however, the expression pattern suggests a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jul 2008]
Mouse(27403) ATP-binding cassette, sub-family A (ABC1), member 7
Rat(299609) ATP-binding cassette, subfamily A (ABC1), member 7
chicken(770610) ATP-binding cassette, sub-family A (ABC1), member 7
dog(485090) ATP-binding cassette, sub-family A (ABC1), member 7
cow(511762) ATP-binding cassette, sub-family A (ABC1), member 7
naked mole-rat(101721589) ATP-binding cassette, sub-family A (ABC1), member 7
domestic guinea pig(100726877) ATP-binding cassette, sub-family A (ABC1), member 7
sheep(101116568) ATP-binding cassette, sub-family A (ABC1), member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019112 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019112 Rosetta Predictions human pricing
NM_033308 Rosetta Predictions human pricing
NM_207598 Rosetta Predictions rat pricing
NM_013850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170979 predicted 3081
2 SASI_Hs01_00170980 predicted 3325
3 SASI_Hs02_00352740 predicted 1222
4 SASI_Hs02_00352741 predicted 5705
5 SASI_Hs02_00352742 predicted 380
6 SASI_Hs01_00170982 predicted 2938
7 SASI_Hs01_00170984 predicted 3734
8 SASI_Hs01_00170983 predicted 5226
9 SASI_Hs01_00170985 predicted 5276
10 SASI_Hs01_00170986 predicted 1105
11 SASI_Hs01_00170981 predicted 5312
12 SASI_Hs01_00170987 predicted 1007
13 SASI_Hs01_00170988 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214388 predicted 2440
2 SASI_Hs01_00214389 predicted 2682
3 SASI_Hs01_00214390 predicted 4777
4 SASI_Hs01_00214391 predicted 2290
5 SASI_Hs01_00214392 predicted 4578
6 SASI_Hs01_00214393 predicted 3095
7 SASI_Hs01_00214394 predicted 4634
8 SASI_Hs01_00214395 predicted 465
9 SASI_Hs01_00214396 predicted 475
10 SASI_Hs01_00214397 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207598 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062293 predicted 4211
2 SASI_Rn01_00062294 predicted 2955
3 SASI_Rn01_00062295 predicted 5839
4 SASI_Rn01_00062297 predicted 1383
5 SASI_Rn01_00062298 predicted 1186
6 SASI_Rn01_00062299 predicted 4224
7 SASI_Rn01_00062300 predicted 888
8 SASI_Rn01_00062301 predicted 1816
9 SASI_Rn01_00062302 predicted 4946
10 SASI_Rn02_00270418 predicted 4923
11 SASI_Rn01_00062296 predicted 4961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033766 predicted 515
2 SASI_Mm01_00033767 predicted 1086
3 SASI_Mm01_00033768 predicted 2463
4 SASI_Mm01_00033769 predicted 4193
5 SASI_Mm01_00033770 predicted 1369
6 SASI_Mm01_00033771 predicted 5809
7 SASI_Mm01_00033773 predicted 1378
8 SASI_Mm01_00033774 predicted 1459
9 SASI_Mm01_00033775 predicted 2921
10 SASI_Mm02_00322856 predicted 539
11 SASI_Mm01_00033772 predicted 5701
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019112
ABCA7 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-5159s1c1
Sequence:CCGGCCGGATCTTGAAACAGGTCTTCTCGAGAAGACCTGTTTCAAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-4325s1c1
Sequence:CCGGGAAGACTAAGAAGTGGGTGAACTCGAGTTCACCCACTTCTTAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-6143s1c1
Sequence:CCGGGCAACATCTCAAGGGCAGATTCTCGAGAATCTGCCCTTGAGATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-1115s1c1
Sequence:CCGGCCGGATCTTCACCTTCATGAACTCGAGTTCATGAAGGTGAAGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-5066s1c1
Sequence:CCGGGCTCACCTGCATAAACCTCTTCTCGAGAAGAGGTTTATGCAGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019112.3-1103s21c1
Sequence:CCGGTCCTCGGGAAGCTACTCTTTGCTCGAGCAAAGAGTAGCTTCCCGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019112.3-5849s21c1
Sequence:CCGGCTCAATCCGATGCCATCTTTGCTCGAGCAAAGATGGCATCGGATTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019112
ABCA7 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-5159s1c1
Sequence:CCGGCCGGATCTTGAAACAGGTCTTCTCGAGAAGACCTGTTTCAAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-4325s1c1
Sequence:CCGGGAAGACTAAGAAGTGGGTGAACTCGAGTTCACCCACTTCTTAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-6143s1c1
Sequence:CCGGGCAACATCTCAAGGGCAGATTCTCGAGAATCTGCCCTTGAGATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-1115s1c1
Sequence:CCGGCCGGATCTTCACCTTCATGAACTCGAGTTCATGAAGGTGAAGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-5066s1c1
Sequence:CCGGGCTCACCTGCATAAACCTCTTCTCGAGAAGAGGTTTATGCAGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019112.3-1103s21c1
Sequence:CCGGTCCTCGGGAAGCTACTCTTTGCTCGAGCAAAGAGTAGCTTCCCGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019112.3-5849s21c1
Sequence:CCGGCTCAATCCGATGCCATCTTTGCTCGAGCAAAGATGGCATCGGATTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019112
ABCA7 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-5159s1c1
Sequence:CCGGCCGGATCTTGAAACAGGTCTTCTCGAGAAGACCTGTTTCAAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-4325s1c1
Sequence:CCGGGAAGACTAAGAAGTGGGTGAACTCGAGTTCACCCACTTCTTAGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-6143s1c1
Sequence:CCGGGCAACATCTCAAGGGCAGATTCTCGAGAATCTGCCCTTGAGATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-1115s1c1
Sequence:CCGGCCGGATCTTCACCTTCATGAACTCGAGTTCATGAAGGTGAAGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019112.2-5066s1c1
Sequence:CCGGGCTCACCTGCATAAACCTCTTCTCGAGAAGAGGTTTATGCAGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019112.3-1103s21c1
Sequence:CCGGTCCTCGGGAAGCTACTCTTTGCTCGAGCAAAGAGTAGCTTCCCGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019112.3-5849s21c1
Sequence:CCGGCTCAATCCGATGCCATCTTTGCTCGAGCAAAGATGGCATCGGATTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013850
VALIDATED
ABCA7 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-2650s1c1
Sequence:CCGGCCGCAGTACAATGTGCTGTTTCTCGAGAAACAGCACATTGTACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013850.1-1836s1c1
Sequence:CCGGGCTAGGGAACATCCTTCCTTACTCGAGTAAGGAAGGATGTTCCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013850.1-4510s1c1
Sequence:CCGGGCCAACAATGGACTCCTACATCTCGAGATGTAGGAGTCCATTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-1374s1c1
Sequence:CCGGCCTACGATTCAAGATTCGAATCTCGAGATTCGAATCTTGAATCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-5925s1c1
Sequence:CCGGGCGATTTCTTTGGAACAGCTTCTCGAGAAGCTGTTCCAAAGAAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1807s21c1
Sequence:CCGGAGCGCTGCGTTGCTGGTATTACTCGAGTAATACCAGCAACGCAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-4180s21c1
Sequence:CCGGCAGAACCTCACTGGCCGAAATCTCGAGATTTCGGCCAGTGAGGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1651s21c1
Sequence:CCGGCTGACTCTGGCCTGGATTTATCTCGAGATAAATCCAGGCCAGAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-712s21c1
Sequence:CCGGTACGAAGCCAACCAGCTTAATCTCGAGATTAAGCTGGTTGGCTTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1094s21c1
Sequence:CCGGAGAAGTTGGAGGCTATCAAAGCTCGAGCTTTGATAGCCTCCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013850
VALIDATED
ABCA7 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-2650s1c1
Sequence:CCGGCCGCAGTACAATGTGCTGTTTCTCGAGAAACAGCACATTGTACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013850.1-1836s1c1
Sequence:CCGGGCTAGGGAACATCCTTCCTTACTCGAGTAAGGAAGGATGTTCCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013850.1-4510s1c1
Sequence:CCGGGCCAACAATGGACTCCTACATCTCGAGATGTAGGAGTCCATTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-1374s1c1
Sequence:CCGGCCTACGATTCAAGATTCGAATCTCGAGATTCGAATCTTGAATCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-5925s1c1
Sequence:CCGGGCGATTTCTTTGGAACAGCTTCTCGAGAAGCTGTTCCAAAGAAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1807s21c1
Sequence:CCGGAGCGCTGCGTTGCTGGTATTACTCGAGTAATACCAGCAACGCAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-4180s21c1
Sequence:CCGGCAGAACCTCACTGGCCGAAATCTCGAGATTTCGGCCAGTGAGGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1651s21c1
Sequence:CCGGCTGACTCTGGCCTGGATTTATCTCGAGATAAATCCAGGCCAGAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-712s21c1
Sequence:CCGGTACGAAGCCAACCAGCTTAATCTCGAGATTAAGCTGGTTGGCTTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1094s21c1
Sequence:CCGGAGAAGTTGGAGGCTATCAAAGCTCGAGCTTTGATAGCCTCCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013850
VALIDATED
ABCA7 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-2650s1c1
Sequence:CCGGCCGCAGTACAATGTGCTGTTTCTCGAGAAACAGCACATTGTACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013850.1-1836s1c1
Sequence:CCGGGCTAGGGAACATCCTTCCTTACTCGAGTAAGGAAGGATGTTCCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013850.1-4510s1c1
Sequence:CCGGGCCAACAATGGACTCCTACATCTCGAGATGTAGGAGTCCATTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-1374s1c1
Sequence:CCGGCCTACGATTCAAGATTCGAATCTCGAGATTCGAATCTTGAATCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013850.1-5925s1c1
Sequence:CCGGGCGATTTCTTTGGAACAGCTTCTCGAGAAGCTGTTCCAAAGAAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1807s21c1
Sequence:CCGGAGCGCTGCGTTGCTGGTATTACTCGAGTAATACCAGCAACGCAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-4180s21c1
Sequence:CCGGCAGAACCTCACTGGCCGAAATCTCGAGATTTCGGCCAGTGAGGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1651s21c1
Sequence:CCGGCTGACTCTGGCCTGGATTTATCTCGAGATAAATCCAGGCCAGAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-712s21c1
Sequence:CCGGTACGAAGCCAACCAGCTTAATCTCGAGATTAAGCTGGTTGGCTTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013850.1-1094s21c1
Sequence:CCGGAGAAGTTGGAGGCTATCAAAGCTCGAGCTTTGATAGCCTCCAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)