EMAIL THIS PAGE TO A FRIEND

Abca8a

32 Gene Product Result for
Gene ID:
Rat(303638) ATP-binding cassette, subfamily A (ABC1), member 8a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061991 MISSION® esiRNA targeting mouse Abca8a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001081603 Rosetta Predictions rat pricing
XM_221100 Rosetta Predictions rat pricing
NM_153145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372619 predicted 2939
2 SASI_Rn02_00372620 predicted 2442
3 SASI_Rn02_00372621 predicted 2558
4 SASI_Rn02_00372622 predicted 2591
5 SASI_Rn02_00372623 predicted 1858
6 SASI_Rn02_00372624 predicted 1178
7 SASI_Rn02_00372625 predicted 3904
8 SASI_Rn02_00372626 predicted 2838
9 SASI_Rn02_00372627 predicted 3619
10 SASI_Rn02_00372628 predicted 3205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379834 predicted 1700
2 SASI_Rn02_00379835 predicted 3076
3 SASI_Rn02_00379836 predicted 2724
4 SASI_Rn02_00379837 predicted 1991
5 SASI_Rn02_00379838 predicted 1319
6 SASI_Rn02_00379839 predicted 4036
7 SASI_Rn02_00379840 predicted 2973
8 SASI_Rn02_00379841 predicted 3756
9 SASI_Rn02_00379842 predicted 3334
10 SASI_Rn02_00379843 predicted 3445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106222 predicted 1269
2 SASI_Mm01_00106223 predicted 267
3 SASI_Mm01_00106224 predicted 1185
4 SASI_Mm01_00106225 predicted 257
5 SASI_Mm01_00106226 predicted 1048
6 SASI_Mm01_00106227 predicted 2158
7 SASI_Mm01_00106228 predicted 2609
8 SASI_Mm01_00106229 predicted 3221
9 SASI_Mm02_00343033 predicted 3711
10 SASI_Mm01_00106231 predicted 2146
11 SASI_Mm01_00106230 predicted 1142
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153145
Abca8a MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-2550s1c1
Sequence:CCGGGCTTCGCTTCTTGAAGTTAAACTCGAGTTTAACTTCAAGAAGCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-4140s1c1
Sequence:CCGGCCTGGAGATATTTGCAGCCATCTCGAGATGGCTGCAAATATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153145.2-5117s1c1
Sequence:CCGGCCTGAGTTTAACTGTTTGTTTCTCGAGAAACAAACAGTTAAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-3642s1c1
Sequence:CCGGCGTAGTTATTCTCCGATGTATCTCGAGATACATCGGAGAATAACTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-1690s1c1
Sequence:CCGGCCACAATGCAATGTGCAATTTCTCGAGAAATTGCACATTGCATTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153145
Abca8a MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-2550s1c1
Sequence:CCGGGCTTCGCTTCTTGAAGTTAAACTCGAGTTTAACTTCAAGAAGCGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000113479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-4140s1c1
Sequence:CCGGCCTGGAGATATTTGCAGCCATCTCGAGATGGCTGCAAATATCTCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000113475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153145.2-5117s1c1
Sequence:CCGGCCTGAGTTTAACTGTTTGTTTCTCGAGAAACAAACAGTTAAACTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000113477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-3642s1c1
Sequence:CCGGCGTAGTTATTCTCCGATGTATCTCGAGATACATCGGAGAATAACTACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000113478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-1690s1c1
Sequence:CCGGCCACAATGCAATGTGCAATTTCTCGAGAAATTGCACATTGCATTGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153145
Abca8a MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-2550s1c1
Sequence:CCGGGCTTCGCTTCTTGAAGTTAAACTCGAGTTTAACTTCAAGAAGCGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-4140s1c1
Sequence:CCGGCCTGGAGATATTTGCAGCCATCTCGAGATGGCTGCAAATATCTCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113475    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153145.2-5117s1c1
Sequence:CCGGCCTGAGTTTAACTGTTTGTTTCTCGAGAAACAAACAGTTAAACTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-3642s1c1
Sequence:CCGGCGTAGTTATTCTCCGATGTATCTCGAGATACATCGGAGAATAACTACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153145.2-1690s1c1
Sequence:CCGGCCACAATGCAATGTGCAATTTCTCGAGAAATTGCACATTGCATTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???