EMAIL THIS PAGE TO A FRIEND

Abcb1a

56 Gene Product Result for
Gene ID:
Rat(170913) ATP-binding cassette, sub-family B (MDR/TAP), member 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C6019 Clotrimazole human, mouse pricing
C3915 Colchicine BioReagent, suitable for plant cell culture, ≥95% (HPLC) human, mouse pricing
C9754 Colchicine ≥95% (HPLC), powder human, mouse pricing
E6376 Erythromycin potency: ≥850 μg per mg human, mouse pricing
E5389 Erythromycin BioReagent, suitable for cell culture human, mouse pricing
45674 Erythromycin tested according to Ph Eur human, mouse pricing
E0774 Erythromycin meets USP testing specifications human, mouse pricing
E7904 Erythromycin Biotechnology Performance Certified human, mouse pricing
I8898 Ivermectin human, mouse pricing
B7005 Betamethasone ≥98% human, mouse, rat pricing
B9675 Betamethasone meets USP testing specifications human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
31375 Dexamethasone tested according to Ph Eur human, mouse, rat pricing
D6770 Digoxin analytical standard human, mouse, rat pricing
E1383 Etoposide synthetic, 98.0-105.0%, powder human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
K1003 Ketoconazole 99.0-101.0% (EP, titration) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
P1793 Pimozide human, mouse, rat pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T9652 Terfenadine human, mouse, rat pricing

Cell Lines

Product # Description Species Add to Cart
 
SBVT19 SB-mouseMdr1a-HEK293 recombinant, expressed in HEK 293 cells mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034911 MISSION® esiRNA esiRNA targeting mouse Abcb1a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133401 Rosetta Predictions rat pricing
NM_011076 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047919 predicted 757
2 SASI_Rn01_00047920 predicted 970
3 SASI_Rn01_00047921 predicted 2982
4 SASI_Rn01_00047922 predicted 2044
5 SASI_Rn01_00047923 predicted 881
6 SASI_Rn01_00047924 predicted 975
7 SASI_Rn02_00267659 predicted 3937
8 SASI_Rn01_00047925 predicted 747
9 SASI_Rn01_00047926 predicted 3983
10 SASI_Rn01_00047928 predicted 3133
11 SASI_Rn01_00047927 predicted 2169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071815 predicted 690
2 SASI_Mm01_00071817 predicted 2782
3 SASI_Mm01_00071818 predicted 2643
4 SASI_Mm01_00071819 predicted 3043
5 SASI_Mm01_00071820 predicted 2650
6 SASI_Mm01_00071821 predicted 808
7 SASI_Mm01_00071822 predicted 2222
8 SASI_Mm01_00071823 predicted 946
9 SASI_Mm01_00071824 predicted 1036
10 SASI_Mm02_00319847 predicted 2664
11 SASI_Mm01_00071816 predicted 2732
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011076
VALIDATED
Abcb1a MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-2276s1c1
Sequence:CCGGGCCATAATAAATGGAGGCTTACTCGAGTAAGCCTCCATTTATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011076.1-3046s1c1
Sequence:CCGGTCTGTTAGTATTCTCAGCTATCTCGAGATAGCTGAGAATACTAACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-458s21c1
Sequence:CCGGGACCACGTACGCCTACTATTACTCGAGTAATAGTAGGCGTACGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-3205s1c1
Sequence:CCGGGCCGAATATGTTGGAAGGAAACTCGAGTTTCCTTCCAACATATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011076.1-4738s1c1
Sequence:CCGGGCACACATTAACCAACGACTACTCGAGTAGTCGTTGGTTAATGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-328s1c1
Sequence:CCGGCCCACTTATGATGCTGATCTTCTCGAGAAGATCAGCATCATAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011076.2-4332s21c1
Sequence:CCGGTGAAACTGAGCATTCATATTTCTCGAGAAATATGAATGCTCAGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-800s21c1
Sequence:CCGGTGGACTGTCAGCTGGTATTTGCTCGAGCAAATACCAGCTGACAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-375s21c1
Sequence:CCGGAGTGTAGGAAACGTCTCTAAACTCGAGTTTAGAGACGTTTCCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-2266s21c1
Sequence:CCGGGTATATTCTGTGCCATAATAACTCGAGTTATTATGGCACAGAATATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011076
VALIDATED
Abcb1a MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-2276s1c1
Sequence:CCGGGCCATAATAAATGGAGGCTTACTCGAGTAAGCCTCCATTTATTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011076.1-3046s1c1
Sequence:CCGGTCTGTTAGTATTCTCAGCTATCTCGAGATAGCTGAGAATACTAACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-458s21c1
Sequence:CCGGGACCACGTACGCCTACTATTACTCGAGTAATAGTAGGCGTACGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-3205s1c1
Sequence:CCGGGCCGAATATGTTGGAAGGAAACTCGAGTTTCCTTCCAACATATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011076.1-4738s1c1
Sequence:CCGGGCACACATTAACCAACGACTACTCGAGTAGTCGTTGGTTAATGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-328s1c1
Sequence:CCGGCCCACTTATGATGCTGATCTTCTCGAGAAGATCAGCATCATAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011076.2-4332s21c1
Sequence:CCGGTGAAACTGAGCATTCATATTTCTCGAGAAATATGAATGCTCAGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-800s21c1
Sequence:CCGGTGGACTGTCAGCTGGTATTTGCTCGAGCAAATACCAGCTGACAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-375s21c1
Sequence:CCGGAGTGTAGGAAACGTCTCTAAACTCGAGTTTAGAGACGTTTCCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-2266s21c1
Sequence:CCGGGTATATTCTGTGCCATAATAACTCGAGTTATTATGGCACAGAATATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011076
VALIDATED
Abcb1a MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-2276s1c1
Sequence:CCGGGCCATAATAAATGGAGGCTTACTCGAGTAAGCCTCCATTTATTATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011076.1-3046s1c1
Sequence:CCGGTCTGTTAGTATTCTCAGCTATCTCGAGATAGCTGAGAATACTAACAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-458s21c1
Sequence:CCGGGACCACGTACGCCTACTATTACTCGAGTAATAGTAGGCGTACGTGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-3205s1c1
Sequence:CCGGGCCGAATATGTTGGAAGGAAACTCGAGTTTCCTTCCAACATATTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111080    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011076.1-4738s1c1
Sequence:CCGGGCACACATTAACCAACGACTACTCGAGTAGTCGTTGGTTAATGTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011076.1-328s1c1
Sequence:CCGGCCCACTTATGATGCTGATCTTCTCGAGAAGATCAGCATCATAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011076.2-4332s21c1
Sequence:CCGGTGAAACTGAGCATTCATATTTCTCGAGAAATATGAATGCTCAGTTTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-800s21c1
Sequence:CCGGTGGACTGTCAGCTGGTATTTGCTCGAGCAAATACCAGCTGACAGTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-375s21c1
Sequence:CCGGAGTGTAGGAAACGTCTCTAAACTCGAGTTTAGAGACGTTTCCTACACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011076.2-2266s21c1
Sequence:CCGGGTATATTCTGTGCCATAATAACTCGAGTTATTATGGCACAGAATATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)