EMAIL THIS PAGE TO A FRIEND

Abcb1b

61 Gene Product Result for
Species: Mouse Abcb1b(18669), Rat Abcb1b(24646), domestic guinea pig Abcb1b(100462896)
Gene ID:
Rat(24646) ATP-binding cassette, subfamily B (MDR/TAP), member 1B
domestic guinea pig(100462896) ATP-binding cassette, sub-family B (MDR/TAP), member 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
C6019 Clotrimazole human, mouse pricing
C3915 Colchicine BioReagent, suitable for plant cell culture, ≥95% (HPLC) human, mouse pricing
C9754 Colchicine ≥95% (HPLC), powder human, mouse pricing
E6376 Erythromycin potency: ≥850 μg per mg human, mouse pricing
E5389 Erythromycin BioReagent, suitable for cell culture human, mouse pricing
45674 Erythromycin tested according to Ph Eur human, mouse pricing
E0774 Erythromycin meets USP testing specifications human, mouse pricing
E7904 Erythromycin Biotechnology Performance Certified human, mouse pricing
I8898 Ivermectin human, mouse pricing
B7005 Betamethasone ≥98% human, mouse, rat pricing
B9675 Betamethasone meets USP testing specifications human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
31375 Dexamethasone tested according to Ph Eur human, mouse, rat pricing
D6770 Digoxin analytical standard human, mouse, rat pricing
E1383 Etoposide synthetic, 98.0-105.0%, powder human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
K1003 Ketoconazole 99.0-101.0% (EP, titration) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
P1793 Pimozide human, mouse, rat pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T9652 Terfenadine human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091761 MISSION® esiRNA esiRNA targeting mouse Abcb1b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012623 Rosetta Predictions rat pricing
NM_011075 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012623 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035645 predicted 595
2 SASI_Rn01_00035646 predicted 1926
3 SASI_Rn01_00035647 predicted 1943
4 SASI_Rn02_00259826 predicted 1014
5 SASI_Rn01_00035648 predicted 1184
6 SASI_Rn01_00035649 predicted 2162
7 SASI_Rn01_00035651 predicted 906
8 SASI_Rn01_00035652 predicted 239
9 SASI_Rn02_00259827 predicted 1078
10 SASI_Rn01_00035653 predicted 598
11 SASI_Rn01_00035650 predicted 660
12 SASI_Rn01_00035654 predicted 2659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011075 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118642 predicted 2265
2 SASI_Mm01_00118644 predicted 2252
3 SASI_Mm01_00118645 predicted 2677
4 SASI_Mm01_00118646 predicted 2175
5 SASI_Mm01_00118647 predicted 2377
6 SASI_Mm01_00118648 predicted 1296
7 SASI_Mm01_00118649 predicted 2137
8 SASI_Mm01_00118650 predicted 843
9 SASI_Mm01_00118651 predicted 2748
10 SASI_Mm02_00319846 predicted 2692
11 SASI_Mm01_00118643 predicted 2767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011075
VALIDATED
Abcb1b MISSION shRNA Bacterial Glycerol Stock
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-396s21c1
Sequence:CCGGGCCAGTATTCTGCCAAGCATTCTCGAGAATGCTTGGCAGAATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-2127s21c1
Sequence:CCGGCCTTTAATAAGGAGATCAATTCTCGAGAATTGATCTCCTTATTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011075.1-4114s1c1
Sequence:CCGGGCCATAGTTAAACAGGGCCATCTCGAGATGGCCCTGTTTAACTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-989s1c1
Sequence:CCGGGCCAGCATTTCGATAGGCATTCTCGAGAATGCCTATCGAAATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-2254s1c1
Sequence:CCGGCGCTGTTATAAATGGGTGCATCTCGAGATGCACCCATTTATAACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-356s1c1
Sequence:CCGGGCCAGTATTCTGCCAAGCATTCTCGAGAATGCTTGGCAGAATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011075.2-4154s21c1
Sequence:CCGGGCCATAGTTAAACAGGGCCATCTCGAGATGGCCCTGTTTAACTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-2716s21c1
Sequence:CCGGCACTTCTACTTGTAGTAATTACTCGAGTAATTACTACAAGTAGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-480s21c1
Sequence:CCGGGCCATATACGCCTACTATTACCTCGAGGTAATAGTAGGCGTATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-2701s1c1
Sequence:CCGGGCTCATTGTATTGGGCGGAATCTCGAGATTCCGCCCAATACAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011075
VALIDATED
Abcb1b MISSION shRNA shRNA Plasmid DNA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-396s21c1
Sequence:CCGGGCCAGTATTCTGCCAAGCATTCTCGAGAATGCTTGGCAGAATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-2127s21c1
Sequence:CCGGCCTTTAATAAGGAGATCAATTCTCGAGAATTGATCTCCTTATTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011075.1-4114s1c1
Sequence:CCGGGCCATAGTTAAACAGGGCCATCTCGAGATGGCCCTGTTTAACTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-989s1c1
Sequence:CCGGGCCAGCATTTCGATAGGCATTCTCGAGAATGCCTATCGAAATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-2254s1c1
Sequence:CCGGCGCTGTTATAAATGGGTGCATCTCGAGATGCACCCATTTATAACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-356s1c1
Sequence:CCGGGCCAGTATTCTGCCAAGCATTCTCGAGAATGCTTGGCAGAATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011075.2-4154s21c1
Sequence:CCGGGCCATAGTTAAACAGGGCCATCTCGAGATGGCCCTGTTTAACTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-2716s21c1
Sequence:CCGGCACTTCTACTTGTAGTAATTACTCGAGTAATTACTACAAGTAGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-480s21c1
Sequence:CCGGGCCATATACGCCTACTATTACCTCGAGGTAATAGTAGGCGTATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-2701s1c1
Sequence:CCGGGCTCATTGTATTGGGCGGAATCTCGAGATTCCGCCCAATACAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011075
VALIDATED
Abcb1b MISSION shRNA Lentiviral Transduction Particles
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-396s21c1
Sequence:CCGGGCCAGTATTCTGCCAAGCATTCTCGAGAATGCTTGGCAGAATACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-2127s21c1
Sequence:CCGGCCTTTAATAAGGAGATCAATTCTCGAGAATTGATCTCCTTATTAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011075.1-4114s1c1
Sequence:CCGGGCCATAGTTAAACAGGGCCATCTCGAGATGGCCCTGTTTAACTATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-989s1c1
Sequence:CCGGGCCAGCATTTCGATAGGCATTCTCGAGAATGCCTATCGAAATGCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-2254s1c1
Sequence:CCGGCGCTGTTATAAATGGGTGCATCTCGAGATGCACCCATTTATAACAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-356s1c1
Sequence:CCGGGCCAGTATTCTGCCAAGCATTCTCGAGAATGCTTGGCAGAATACTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011075.2-4154s21c1
Sequence:CCGGGCCATAGTTAAACAGGGCCATCTCGAGATGGCCCTGTTTAACTATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-2716s21c1
Sequence:CCGGCACTTCTACTTGTAGTAATTACTCGAGTAATTACTACAAGTAGAAGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011075.2-480s21c1
Sequence:CCGGGCCATATACGCCTACTATTACCTCGAGGTAATAGTAGGCGTATATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011075.1-2701s1c1
Sequence:CCGGGCTCATTGTATTGGGCGGAATCTCGAGATTCCGCCCAATACAATGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)