EMAIL THIS PAGE TO A FRIEND

ABCF1

ATP-binding cassette, sub-family F (GCN20), member 1

109 Gene Product Result for
Synonyms: ABC27 ABC50
UniProtKB ID: Q8NE71, A2BF75, O14897, Q69YP6
Gene ID:
Human(23) Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq, Jul 2008]
Mouse(224742) ATP-binding cassette, sub-family F (GCN20), member 1
Rat(85493) ATP-binding cassette, subfamily F (GCN20), member 1
Zebrafish(406467) ATP-binding cassette, sub-family F (GCN20), member 1
cow(281589) ATP-binding cassette, sub-family F (GCN20), member 1
domestic cat(101092269) ATP-binding cassette, sub-family F (GCN20), member 1
dog(474826) ATP-binding cassette, sub-family F (GCN20), member 1
domestic guinea pig(100720913) ATP-binding cassette, sub-family F (GCN20), member 1
naked mole-rat(101709485) ATP-binding cassette, sub-family F (GCN20), member 1
sheep(101103598) ATP-binding cassette, sub-family F (GCN20), member 1
Domestic Rabbit(100357392) ATP-binding cassette, sub-family F (GCN20), member 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001090 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007591 MISSION® esiRNA esiRNA targeting mouse Abcf1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025091 Rosetta Predictions human pricing
NM_001090 Rosetta Predictions human pricing
NM_001109883 Rosetta Predictions rat pricing
XM_001062137 Rosetta Predictions rat pricing
NM_013854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307358 predicted 1621
2 SASI_Hs02_00307359 predicted 2004
3 SASI_Hs01_00198589 predicted 1409
4 SASI_Hs01_00198591 predicted 2003
5 SASI_Hs01_00198592 predicted 2056
6 SASI_Hs02_00307360 predicted 2655
7 SASI_Hs01_00198593 predicted 2227
8 SASI_Hs01_00198594 predicted 2539
9 SASI_Hs01_00198595 predicted 2396
10 SASI_Hs01_00198596 predicted 2331
11 SASI_Hs01_00198590 predicted 2372
12 SASI_Hs01_00198597 predicted 2142
13 SASI_Hs01_00198598 predicted 2049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318075 predicted 1514
2 SASI_Hs02_00318076 predicted 1889
3 SASI_Hs01_00201057 predicted 1287
4 SASI_Hs01_00201059 predicted 1883
5 SASI_Hs01_00201060 predicted 1945
6 SASI_Hs02_00318077 predicted 2545
7 SASI_Hs01_00201061 predicted 2120
8 SASI_Hs01_00201062 predicted 2428
9 SASI_Hs01_00201063 predicted 2289
10 SASI_Hs01_00201064 predicted 2216
11 SASI_Hs01_00201058 predicted 2264
12 SASI_Hs01_00201065 predicted 2028
13 SASI_Hs01_00201066 predicted 1933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250682 predicted 2156
2 SASI_Rn02_00250683 predicted 1561
3 SASI_Rn02_00250684 predicted 799
4 SASI_Rn02_00250685 predicted 2253
5 SASI_Rn02_00250686 predicted 2549
6 SASI_Rn02_00250687 predicted 1478
7 SASI_Rn02_00250688 predicted 2583
8 SASI_Rn02_00250689 predicted 1336
9 SASI_Rn02_00250690 predicted 2325
10 SASI_Rn02_00250691 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302494 predicted 2053
2 SASI_Rn02_00302495 predicted 1455
3 SASI_Rn02_00302496 predicted 1982
4 SASI_Rn02_00302497 predicted 698
5 SASI_Rn02_00302498 predicted 2145
6 SASI_Rn02_00302499 predicted 1371
7 SASI_Rn02_00302500 predicted 1221
8 SASI_Rn02_00302501 predicted 1820
9 SASI_Rn02_00302502 predicted 2213
10 SASI_Rn02_00302503 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125927 predicted 2055
2 SASI_Mm02_00322866 predicted 1921
3 SASI_Mm02_00322867 predicted 2374
4 SASI_Mm01_00125919 predicted 488
5 SASI_Mm02_00322868 predicted 1646
6 SASI_Mm02_00322869 predicted 1459
7 SASI_Mm02_00322870 predicted 2311
8 SASI_Mm01_00125920 predicted 290
9 SASI_Mm02_00322871 predicted 2569
10 SASI_Mm02_00322872 predicted 1438
11 SASI_Mm01_00125918 predicted 260
12 SASI_Mm01_00125921 predicted 501
13 SASI_Mm01_00125922 predicted 1218
14 SASI_Mm01_00125923 predicted 1343
15 SASI_Mm01_00125924 predicted 2485
16 SASI_Mm01_00125925 predicted 321
17 SASI_Mm01_00125926 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001090
ABCF1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family F (GCN20), member 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-1432s1c1
Sequence:CCGGCAACGCTGTCATCTGGCTTAACTCGAGTTAAGCCAGATGACAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-2422s1c1
Sequence:CCGGGCAGAGTGTTAGCCAAATCGACTCGAGTCGATTTGGCTAACACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-2284s1c1
Sequence:CCGGGCCAACCAATAACCTGGACATCTCGAGATGTCCAGGTTATTGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001090.1-2623s1c1
Sequence:CCGGGCAACCATTCAGGCACATGAACTCGAGTTCATGTGCCTGAATGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-391s1c1
Sequence:CCGGGCGTCTTAAGAAGCTCTCAGTCTCGAGACTGAGAGCTTCTTAAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-1048s1c1
Sequence:CCGGCCCTCCCAACATTGATGTGTTCTCGAGAACACATCAATGTTGGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-561s1c1
Sequence:CCGGCGGAGAAGAATCGGATCAATACTCGAGTATTGATCCGATTCTTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-1435s1c1
Sequence:CCGGCGCTGTCATCTGGCTTAATAACTCGAGTTATTAAGCCAGATGACAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001090.1-2806s1c1
Sequence:CCGGGCCAAGTTTATGTGGCCTATTCTCGAGAATAGGCCACATAAACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-2423s21c1
Sequence:CCGGGCAGAGTGTTAGCCAAATCGACTCGAGTCGATTTGGCTAACACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001090.2-2806s21c1
Sequence:CCGGGCCAAGTTTATGTGGCCTATTCTCGAGAATAGGCCACATAAACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-562s21c1
Sequence:CCGGCGGAGAAGAATCGGATCAATACTCGAGTATTGATCCGATTCTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-1436s21c1
Sequence:CCGGCGCTGTCATCTGGCTTAATAACTCGAGTTATTAAGCCAGATGACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001090
ABCF1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family F (GCN20), member 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-1432s1c1
Sequence:CCGGCAACGCTGTCATCTGGCTTAACTCGAGTTAAGCCAGATGACAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-2422s1c1
Sequence:CCGGGCAGAGTGTTAGCCAAATCGACTCGAGTCGATTTGGCTAACACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-2284s1c1
Sequence:CCGGGCCAACCAATAACCTGGACATCTCGAGATGTCCAGGTTATTGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001090.1-2623s1c1
Sequence:CCGGGCAACCATTCAGGCACATGAACTCGAGTTCATGTGCCTGAATGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-391s1c1
Sequence:CCGGGCGTCTTAAGAAGCTCTCAGTCTCGAGACTGAGAGCTTCTTAAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-1048s1c1
Sequence:CCGGCCCTCCCAACATTGATGTGTTCTCGAGAACACATCAATGTTGGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-561s1c1
Sequence:CCGGCGGAGAAGAATCGGATCAATACTCGAGTATTGATCCGATTCTTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-1435s1c1
Sequence:CCGGCGCTGTCATCTGGCTTAATAACTCGAGTTATTAAGCCAGATGACAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001090.1-2806s1c1
Sequence:CCGGGCCAAGTTTATGTGGCCTATTCTCGAGAATAGGCCACATAAACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-2423s21c1
Sequence:CCGGGCAGAGTGTTAGCCAAATCGACTCGAGTCGATTTGGCTAACACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001090.2-2806s21c1
Sequence:CCGGGCCAAGTTTATGTGGCCTATTCTCGAGAATAGGCCACATAAACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-562s21c1
Sequence:CCGGCGGAGAAGAATCGGATCAATACTCGAGTATTGATCCGATTCTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-1436s21c1
Sequence:CCGGCGCTGTCATCTGGCTTAATAACTCGAGTTATTAAGCCAGATGACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001090
ABCF1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family F (GCN20), member 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-1432s1c1
Sequence:CCGGCAACGCTGTCATCTGGCTTAACTCGAGTTAAGCCAGATGACAGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-2422s1c1
Sequence:CCGGGCAGAGTGTTAGCCAAATCGACTCGAGTCGATTTGGCTAACACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-2284s1c1
Sequence:CCGGGCCAACCAATAACCTGGACATCTCGAGATGTCCAGGTTATTGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001090.1-2623s1c1
Sequence:CCGGGCAACCATTCAGGCACATGAACTCGAGTTCATGTGCCTGAATGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-391s1c1
Sequence:CCGGGCGTCTTAAGAAGCTCTCAGTCTCGAGACTGAGAGCTTCTTAAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001090.1-1048s1c1
Sequence:CCGGCCCTCCCAACATTGATGTGTTCTCGAGAACACATCAATGTTGGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-561s1c1
Sequence:CCGGCGGAGAAGAATCGGATCAATACTCGAGTATTGATCCGATTCTTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001090.1-1435s1c1
Sequence:CCGGCGCTGTCATCTGGCTTAATAACTCGAGTTATTAAGCCAGATGACAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001090.1-2806s1c1
Sequence:CCGGGCCAAGTTTATGTGGCCTATTCTCGAGAATAGGCCACATAAACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-2423s21c1
Sequence:CCGGGCAGAGTGTTAGCCAAATCGACTCGAGTCGATTTGGCTAACACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001090.2-2806s21c1
Sequence:CCGGGCCAAGTTTATGTGGCCTATTCTCGAGAATAGGCCACATAAACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-562s21c1
Sequence:CCGGCGGAGAAGAATCGGATCAATACTCGAGTATTGATCCGATTCTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001090.2-1436s21c1
Sequence:CCGGCGCTGTCATCTGGCTTAATAACTCGAGTTATTAAGCCAGATGACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013854
VALIDATED
ABCF1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family F (GCN20), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-101s1c1
Sequence:CCGGCGCGGACAAAGTAGTGAAGAACTCGAGTTCTTCACTACTTTGTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2471s1c1
Sequence:CCGGCGGCGACTTTGATGACTACAACTCGAGTTGTAGTCATCAAAGTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-909s1c1
Sequence:CCGGGCATCTGACATTAAGTTGGAACTCGAGTTCCAACTTAATGTCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2313s1c1
Sequence:CCGGCCAACCAATAACTTGGACATACTCGAGTATGTCCAAGTTATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2901s1c1
Sequence:CCGGGCCTCTTGTCTCAAGACCTTTCTCGAGAAAGGTCTTGAGACAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-909s21c1
Sequence:CCGGGCATCTGACATTAAGTTGGAACTCGAGTTCCAACTTAATGTCAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-101s21c1
Sequence:CCGGCGCGGACAAAGTAGTGAAGAACTCGAGTTCTTCACTACTTTGTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013854.1-2901s21c1
Sequence:CCGGGCCTCTTGTCTCAAGACCTTTCTCGAGAAAGGTCTTGAGACAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-2471s21c1
Sequence:CCGGCGGCGACTTTGATGACTACAACTCGAGTTGTAGTCATCAAAGTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-2313s21c1
Sequence:CCGGCCAACCAATAACTTGGACATACTCGAGTATGTCCAAGTTATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013854
VALIDATED
ABCF1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family F (GCN20), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-101s1c1
Sequence:CCGGCGCGGACAAAGTAGTGAAGAACTCGAGTTCTTCACTACTTTGTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2471s1c1
Sequence:CCGGCGGCGACTTTGATGACTACAACTCGAGTTGTAGTCATCAAAGTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-909s1c1
Sequence:CCGGGCATCTGACATTAAGTTGGAACTCGAGTTCCAACTTAATGTCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2313s1c1
Sequence:CCGGCCAACCAATAACTTGGACATACTCGAGTATGTCCAAGTTATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2901s1c1
Sequence:CCGGGCCTCTTGTCTCAAGACCTTTCTCGAGAAAGGTCTTGAGACAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-909s21c1
Sequence:CCGGGCATCTGACATTAAGTTGGAACTCGAGTTCCAACTTAATGTCAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-101s21c1
Sequence:CCGGCGCGGACAAAGTAGTGAAGAACTCGAGTTCTTCACTACTTTGTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013854.1-2901s21c1
Sequence:CCGGGCCTCTTGTCTCAAGACCTTTCTCGAGAAAGGTCTTGAGACAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-2471s21c1
Sequence:CCGGCGGCGACTTTGATGACTACAACTCGAGTTGTAGTCATCAAAGTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-2313s21c1
Sequence:CCGGCCAACCAATAACTTGGACATACTCGAGTATGTCCAAGTTATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013854
VALIDATED
ABCF1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family F (GCN20), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-101s1c1
Sequence:CCGGCGCGGACAAAGTAGTGAAGAACTCGAGTTCTTCACTACTTTGTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2471s1c1
Sequence:CCGGCGGCGACTTTGATGACTACAACTCGAGTTGTAGTCATCAAAGTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-909s1c1
Sequence:CCGGGCATCTGACATTAAGTTGGAACTCGAGTTCCAACTTAATGTCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2313s1c1
Sequence:CCGGCCAACCAATAACTTGGACATACTCGAGTATGTCCAAGTTATTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013854.1-2901s1c1
Sequence:CCGGGCCTCTTGTCTCAAGACCTTTCTCGAGAAAGGTCTTGAGACAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-909s21c1
Sequence:CCGGGCATCTGACATTAAGTTGGAACTCGAGTTCCAACTTAATGTCAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-101s21c1
Sequence:CCGGCGCGGACAAAGTAGTGAAGAACTCGAGTTCTTCACTACTTTGTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013854.1-2901s21c1
Sequence:CCGGGCCTCTTGTCTCAAGACCTTTCTCGAGAAAGGTCTTGAGACAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-2471s21c1
Sequence:CCGGCGGCGACTTTGATGACTACAACTCGAGTTGTAGTCATCAAAGTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013854.1-2313s21c1
Sequence:CCGGCCAACCAATAACTTGGACATACTCGAGTATGTCCAAGTTATTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)