EMAIL THIS PAGE TO A FRIEND

Abcg3

34 Gene Product Result for
Gene ID:
Rat(498327) ATP-binding cassette, subfamily G (WHITE), member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065001 MISSION® esiRNA targeting mouse Abcg3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128311 Rosetta Predictions rat pricing
XR_008179 Rosetta Predictions rat pricing
NM_030239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255170 predicted 1218
2 SASI_Rn02_00255171 predicted 1153
3 SASI_Rn02_00255172 predicted 1657
4 SASI_Rn02_00255173 predicted 1214
5 SASI_Rn02_00255174 predicted 625
6 SASI_Rn02_00255175 predicted 1657
7 SASI_Rn02_00255176 predicted 1734
8 SASI_Rn02_00255177 predicted 1304
9 SASI_Rn02_00255178 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008179 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125914 predicted 1650
2 SASI_Rn01_00125915 predicted 1886
3 SASI_Rn01_00125916 predicted 1421
4 SASI_Rn02_00416415 predicted 162
5 SASI_Rn01_00125917 predicted 1935
6 SASI_Rn01_00125918 predicted 69
7 SASI_Rn01_00125919 predicted 1935
8 SASI_Rn01_00125920 predicted 1361
9 SASI_Rn02_00416416 predicted 1857
10 SASI_Rn02_00416417 predicted 1935
11 SASI_Rn01_00125911 predicted 229
12 SASI_Rn01_00125912 predicted 227
13 SASI_Rn01_00125913 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070183 predicted 479
2 SASI_Mm01_00070184 predicted 658
3 SASI_Mm01_00070185 predicted 1340
4 SASI_Mm01_00070186 predicted 1509
5 SASI_Mm01_00070188 predicted 2095
6 SASI_Mm01_00070189 predicted 995
7 SASI_Mm01_00070190 predicted 2185
8 SASI_Mm01_00070191 predicted 1356
9 SASI_Mm02_00336701 predicted 1947
10 SASI_Mm01_00070192 predicted 1297
11 SASI_Mm01_00070187 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030239
Abcg3 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030239.2-2584s1c1
Sequence:CCGGGCAGTCATTGATTCACATTTACTCGAGTAAATGTGAATCAATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-2057s1c1
Sequence:CCGGCCTGGCTTTAGTTTGTACAATCTCGAGATTGTACAAACTAAAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-633s1c1
Sequence:CCGGCCAGTGACTATAACAAGAGATCTCGAGATCTCTTGTTATAGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-485s1c1
Sequence:CCGGGCGTGGATTATCAGGAGATATCTCGAGATATCTCCTGATAATCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-529s1c1
Sequence:CCGGCTGCTAATTTCAAGTGTACTTCTCGAGAAGTACACTTGAAATTAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030239
Abcg3 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030239.2-2584s1c1
Sequence:CCGGGCAGTCATTGATTCACATTTACTCGAGTAAATGTGAATCAATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-2057s1c1
Sequence:CCGGCCTGGCTTTAGTTTGTACAATCTCGAGATTGTACAAACTAAAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-633s1c1
Sequence:CCGGCCAGTGACTATAACAAGAGATCTCGAGATCTCTTGTTATAGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-485s1c1
Sequence:CCGGGCGTGGATTATCAGGAGATATCTCGAGATATCTCCTGATAATCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-529s1c1
Sequence:CCGGCTGCTAATTTCAAGTGTACTTCTCGAGAAGTACACTTGAAATTAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030239
Abcg3 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030239.2-2584s1c1
Sequence:CCGGGCAGTCATTGATTCACATTTACTCGAGTAAATGTGAATCAATGACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-2057s1c1
Sequence:CCGGCCTGGCTTTAGTTTGTACAATCTCGAGATTGTACAAACTAAAGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-633s1c1
Sequence:CCGGCCAGTGACTATAACAAGAGATCTCGAGATCTCTTGTTATAGTCACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-485s1c1
Sequence:CCGGGCGTGGATTATCAGGAGATATCTCGAGATATCTCCTGATAATCCACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000110874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030239.2-529s1c1
Sequence:CCGGCTGCTAATTTCAAGTGTACTTCTCGAGAAGTACACTTGAAATTAGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???