EMAIL THIS PAGE TO A FRIEND

ABHD5

abhydrolase domain containing 5

55 Gene Product Result for
Synonyms: CDS CGI58 IECN2 NCIE2
UniProtKB ID: Q8WTS1, B2R9K0, Q9Y369
Gene ID:
Human(51099) Summary: The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq, Jul 2008]
Mouse(67469) abhydrolase domain containing 5
Rat(316122) abhydrolase domain containing 5
chicken(420673) abhydrolase domain containing 5
dog(485570) abhydrolase domain containing 5
domestic cat(101095040) abhydrolase domain containing 5
Horse(100066775) abhydrolase domain containing 5
cow(535588) abhydrolase domain containing 5
sheep(100125355) abhydrolase domain containing 5
domestic guinea pig(100735683) abhydrolase domain containing 5
naked mole-rat(101708455) abhydrolase domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016006 Rosetta Predictions human pricing
NM_212524 Rosetta Predictions rat pricing
NM_026179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044835 predicted 587
2 SASI_Hs01_00044836 predicted 729
3 SASI_Hs01_00044837 predicted 551
4 SASI_Hs01_00044838 predicted 462
5 SASI_Hs01_00044839 predicted 607
6 SASI_Hs01_00044840 predicted 688
7 SASI_Hs01_00044841 predicted 668
8 SASI_Hs01_00044842 predicted 836
9 SASI_Hs01_00044843 predicted 1039
10 SASI_Hs02_00348684 predicted 961
11 SASI_Hs01_00044834 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071859 predicted 366
2 SASI_Rn01_00071860 predicted 747
3 SASI_Rn01_00071861 predicted 494
4 SASI_Rn01_00071862 predicted 252
5 SASI_Rn01_00071863 predicted 310
6 SASI_Rn01_00071864 predicted 777
7 SASI_Rn01_00071865 predicted 397
8 SASI_Rn01_00071866 predicted 622
9 SASI_Rn01_00071867 predicted 237
10 SASI_Rn01_00071868 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153418 predicted 498
2 SASI_Mm01_00153419 predicted 624
3 SASI_Mm01_00153420 predicted 442
4 SASI_Mm01_00153421 predicted 911
5 SASI_Mm01_00153422 predicted 245
6 SASI_Mm01_00153423 predicted 752
7 SASI_Mm01_00153424 predicted 721
8 SASI_Mm01_00153425 predicted 1022
9 SASI_Mm01_00153426 predicted 485
10 SASI_Mm01_00153427 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016006
ABHD5 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-798s1c1
Sequence:CCGGCCTGATTTCAAACGAAAGTATCTCGAGATACTTTCGTTTGAAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-971s1c1
Sequence:CCGGCATTCCAGTTTCAGTGATCTTCTCGAGAAGATCACTGAAACTGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-450s1c1
Sequence:CCGGCGAAGTAGTAGACCCAGGTTTCTCGAGAAACCTGGGTCTACTACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-785s1c1
Sequence:CCGGGCAGCGTTTAAGGCCTGATTTCTCGAGAAATCAGGCCTTAAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-195s1c1
Sequence:CCGGCCTACGTCTATATCACACCTTCTCGAGAAGGTGTGATATAGACGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-785s21c1
Sequence:CCGGGCAGCGTTTAAGGCCTGATTTCTCGAGAAATCAGGCCTTAAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-971s21c1
Sequence:CCGGCATTCCAGTTTCAGTGATCTTCTCGAGAAGATCACTGAAACTGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-195s21c1
Sequence:CCGGCCTACGTCTATATCACACCTTCTCGAGAAGGTGTGATATAGACGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-798s21c1
Sequence:CCGGCCTGATTTCAAACGAAAGTATCTCGAGATACTTTCGTTTGAAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016006
ABHD5 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-798s1c1
Sequence:CCGGCCTGATTTCAAACGAAAGTATCTCGAGATACTTTCGTTTGAAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-971s1c1
Sequence:CCGGCATTCCAGTTTCAGTGATCTTCTCGAGAAGATCACTGAAACTGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-450s1c1
Sequence:CCGGCGAAGTAGTAGACCCAGGTTTCTCGAGAAACCTGGGTCTACTACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-785s1c1
Sequence:CCGGGCAGCGTTTAAGGCCTGATTTCTCGAGAAATCAGGCCTTAAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-195s1c1
Sequence:CCGGCCTACGTCTATATCACACCTTCTCGAGAAGGTGTGATATAGACGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-785s21c1
Sequence:CCGGGCAGCGTTTAAGGCCTGATTTCTCGAGAAATCAGGCCTTAAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-971s21c1
Sequence:CCGGCATTCCAGTTTCAGTGATCTTCTCGAGAAGATCACTGAAACTGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-195s21c1
Sequence:CCGGCCTACGTCTATATCACACCTTCTCGAGAAGGTGTGATATAGACGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-798s21c1
Sequence:CCGGCCTGATTTCAAACGAAAGTATCTCGAGATACTTTCGTTTGAAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016006
ABHD5 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-798s1c1
Sequence:CCGGCCTGATTTCAAACGAAAGTATCTCGAGATACTTTCGTTTGAAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-971s1c1
Sequence:CCGGCATTCCAGTTTCAGTGATCTTCTCGAGAAGATCACTGAAACTGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-450s1c1
Sequence:CCGGCGAAGTAGTAGACCCAGGTTTCTCGAGAAACCTGGGTCTACTACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-785s1c1
Sequence:CCGGGCAGCGTTTAAGGCCTGATTTCTCGAGAAATCAGGCCTTAAACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016006.3-195s1c1
Sequence:CCGGCCTACGTCTATATCACACCTTCTCGAGAAGGTGTGATATAGACGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-785s21c1
Sequence:CCGGGCAGCGTTTAAGGCCTGATTTCTCGAGAAATCAGGCCTTAAACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-971s21c1
Sequence:CCGGCATTCCAGTTTCAGTGATCTTCTCGAGAAGATCACTGAAACTGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-195s21c1
Sequence:CCGGCCTACGTCTATATCACACCTTCTCGAGAAGGTGTGATATAGACGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016006.4-798s21c1
Sequence:CCGGCCTGATTTCAAACGAAAGTATCTCGAGATACTTTCGTTTGAAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026179
VALIDATED
ABHD5 MISSION shRNA Bacterial Glycerol Stock
abhydrolase domain containing 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-1291s1c1
Sequence:CCGGCCCAATTTAATAATCGCCTTACTCGAGTAAGGCGATTATTAAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-1063s1c1
Sequence:CCGGCCAGAAGAATTCAACCAGAAACTCGAGTTTCTGGTTGAATTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-149s1c1
Sequence:CCGGCCACATCTACATCACACCTTACTCGAGTAAGGTGTGATGTAGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026179.1-258s1c1
Sequence:CCGGGCTGATGTTCTCTCACAACATCTCGAGATGTTGTGAGAGAACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-750s1c1
Sequence:CCGGGCCTGATTTCAAGCGGAAGTACTCGAGTACTTCCGCTTGAAATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026179.2-1495s21c1
Sequence:CCGGTAACTGCTTGTTAGGTGTTTGCTCGAGCAAACACCTAACAAGCAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026179.2-1668s21c1
Sequence:CCGGACATAGTTAACCCAAGTATTTCTCGAGAAATACTTGGGTTAACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-1177s21c1
Sequence:CCGGCCAGAAGAATTCAACCAGAAACTCGAGTTTCTGGTTGAATTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-864s21c1
Sequence:CCGGGCCTGATTTCAAGCGGAAGTACTCGAGTACTTCCGCTTGAAATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-372s21c1
Sequence:CCGGGCTGATGTTCTCTCACAACATCTCGAGATGTTGTGAGAGAACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026179
VALIDATED
ABHD5 MISSION shRNA shRNA Plasmid DNA
abhydrolase domain containing 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-1291s1c1
Sequence:CCGGCCCAATTTAATAATCGCCTTACTCGAGTAAGGCGATTATTAAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-1063s1c1
Sequence:CCGGCCAGAAGAATTCAACCAGAAACTCGAGTTTCTGGTTGAATTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-149s1c1
Sequence:CCGGCCACATCTACATCACACCTTACTCGAGTAAGGTGTGATGTAGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026179.1-258s1c1
Sequence:CCGGGCTGATGTTCTCTCACAACATCTCGAGATGTTGTGAGAGAACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-750s1c1
Sequence:CCGGGCCTGATTTCAAGCGGAAGTACTCGAGTACTTCCGCTTGAAATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026179.2-1495s21c1
Sequence:CCGGTAACTGCTTGTTAGGTGTTTGCTCGAGCAAACACCTAACAAGCAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026179.2-1668s21c1
Sequence:CCGGACATAGTTAACCCAAGTATTTCTCGAGAAATACTTGGGTTAACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-1177s21c1
Sequence:CCGGCCAGAAGAATTCAACCAGAAACTCGAGTTTCTGGTTGAATTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-864s21c1
Sequence:CCGGGCCTGATTTCAAGCGGAAGTACTCGAGTACTTCCGCTTGAAATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-372s21c1
Sequence:CCGGGCTGATGTTCTCTCACAACATCTCGAGATGTTGTGAGAGAACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026179
VALIDATED
ABHD5 MISSION shRNA Lentiviral Transduction Particles
abhydrolase domain containing 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-1291s1c1
Sequence:CCGGCCCAATTTAATAATCGCCTTACTCGAGTAAGGCGATTATTAAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-1063s1c1
Sequence:CCGGCCAGAAGAATTCAACCAGAAACTCGAGTTTCTGGTTGAATTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-149s1c1
Sequence:CCGGCCACATCTACATCACACCTTACTCGAGTAAGGTGTGATGTAGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026179.1-258s1c1
Sequence:CCGGGCTGATGTTCTCTCACAACATCTCGAGATGTTGTGAGAGAACATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026179.1-750s1c1
Sequence:CCGGGCCTGATTTCAAGCGGAAGTACTCGAGTACTTCCGCTTGAAATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026179.2-1495s21c1
Sequence:CCGGTAACTGCTTGTTAGGTGTTTGCTCGAGCAAACACCTAACAAGCAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026179.2-1668s21c1
Sequence:CCGGACATAGTTAACCCAAGTATTTCTCGAGAAATACTTGGGTTAACTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-1177s21c1
Sequence:CCGGCCAGAAGAATTCAACCAGAAACTCGAGTTTCTGGTTGAATTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-864s21c1
Sequence:CCGGGCCTGATTTCAAGCGGAAGTACTCGAGTACTTCCGCTTGAAATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026179.2-372s21c1
Sequence:CCGGGCTGATGTTCTCTCACAACATCTCGAGATGTTGTGAGAGAACATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)