EMAIL THIS PAGE TO A FRIEND

ABTB2

ankyrin repeat and BTB (POZ) domain containing 2

68 Gene Product Result for
Synonyms: BTBD22
UniProtKB ID: Q8N961, A8K6S9, E9PRW7, Q52LD6, Q6MZW4, Q8NB44
Gene ID:
Mouse(99382) ankyrin repeat and BTB (POZ) domain containing 2
Rat(171440) ankyrin repeat and BTB (POZ) domain containing 2
domestic guinea pig(100732805) ankyrin repeat and BTB (POZ) domain containing 2
naked mole-rat(101708552) ankyrin repeat and BTB (POZ) domain containing 2
sheep(101103837) ankyrin repeat and BTB (POZ) domain containing 2
chicken(425717) ankyrin repeat and BTB (POZ) domain containing 2
cow(528597) ankyrin repeat and BTB (POZ) domain containing 2
Horse(100060581) ankyrin repeat and BTB (POZ) domain containing 2
domestic cat(101093642) ankyrin repeat and BTB (POZ) domain containing 2
dog(483430) ankyrin repeat and BTB (POZ) domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145804 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145804 Rosetta Predictions human pricing
NM_134403 Rosetta Predictions rat pricing
NM_178890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080014 predicted 1382
2 SASI_Hs01_00080015 predicted 887
3 SASI_Hs01_00080017 predicted 2275
4 SASI_Hs01_00080018 predicted 1227
5 SASI_Hs01_00080019 predicted 280
6 SASI_Hs02_00365359 predicted 2264
7 SASI_Hs01_00080020 predicted 1055
8 SASI_Hs01_00080022 predicted 1829
9 SASI_Hs01_00080023 predicted 834
10 SASI_Hs02_00365360 predicted 2290
11 SASI_Hs01_00080016 predicted 2242
12 SASI_Hs01_00080021 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106277 predicted 2488
2 SASI_Rn01_00106278 predicted 3511
3 SASI_Rn01_00106280 predicted 3216
4 SASI_Rn01_00106281 predicted 3061
5 SASI_Rn01_00106282 predicted 1309
6 SASI_Rn02_00267996 predicted 3255
7 SASI_Rn01_00106283 predicted 2564
8 SASI_Rn01_00106284 predicted 3448
9 SASI_Rn01_00106285 predicted 1629
10 SASI_Rn01_00106286 predicted 3154
11 SASI_Rn01_00106279 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058605 predicted 3019
2 SASI_Mm01_00058606 predicted 3259
3 SASI_Mm01_00058607 predicted 2031
4 SASI_Mm01_00058609 predicted 3073
5 SASI_Mm01_00058610 predicted 3526
6 SASI_Mm01_00058611 predicted 1310
7 SASI_Mm01_00058612 predicted 2132
8 SASI_Mm01_00058613 predicted 1971
9 SASI_Mm01_00058614 predicted 2495
10 SASI_Mm02_00349481 predicted 1021
11 SASI_Mm01_00058608 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145804
VALIDATED
ABTB2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and BTB (POZ) domain containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-823s21c1
Sequence:CCGGTCCACACGCTCTACTACTTTCCTCGAGGAAAGTAGTAGAGCGTGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-2914s21c1
Sequence:CCGGGCCCTAGAGCTGTTTGTTCAACTCGAGTTGAACAAACAGCTCTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145804.1-2344s21c1
Sequence:CCGGGCGACATGAAGTACCACATTTCTCGAGAAATGTGGTACTTCATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145804.1-2525s21c1
Sequence:CCGGTGCCGTGAACACCTACAAATACTCGAGTATTTGTAGGTGTTCACGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-2284s21c1
Sequence:CCGGAGACACTAATGACCAATAAATCTCGAGATTTATTGGTCATTAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145804.1-1308s1c1
Sequence:CCGGGCAAACTTGGACATCCAGGTTCTCGAGAACCTGGATGTCCAAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-824s1c1
Sequence:CCGGCCACACGCTCTACTACTTTCTCTCGAGAGAAAGTAGTAGAGCGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145804.1-3646s1c1
Sequence:CCGGCGGCTCCTTTAATGTAGGATTCTCGAGAATCCTACATTAAAGGAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-2531s1c1
Sequence:CCGGGAACACCTACAAATATGCCAACTCGAGTTGGCATATTTGTAGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145804.1-2039s1c1
Sequence:CCGGGCTCATGTTCGACATCCTCAACTCGAGTTGAGGATGTCGAACATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145804.1-2914s1c1
Sequence:CCGGGCCCTAGAGCTGTTTGTTCAACTCGAGTTGAACAAACAGCTCTAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145804.1-3108s1c1
Sequence:CCGGGCCTCAGTAAACTCAGACCATCTCGAGATGGTCTGAGTTTACTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-1064s1c1
Sequence:CCGGGCTCAAACCCGAACACTGTTTCTCGAGAAACAGTGTTCGGGTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145804
VALIDATED
ABTB2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and BTB (POZ) domain containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-823s21c1
Sequence:CCGGTCCACACGCTCTACTACTTTCCTCGAGGAAAGTAGTAGAGCGTGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-2914s21c1
Sequence:CCGGGCCCTAGAGCTGTTTGTTCAACTCGAGTTGAACAAACAGCTCTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145804.1-2344s21c1
Sequence:CCGGGCGACATGAAGTACCACATTTCTCGAGAAATGTGGTACTTCATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145804.1-2525s21c1
Sequence:CCGGTGCCGTGAACACCTACAAATACTCGAGTATTTGTAGGTGTTCACGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-2284s21c1
Sequence:CCGGAGACACTAATGACCAATAAATCTCGAGATTTATTGGTCATTAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145804.1-1308s1c1
Sequence:CCGGGCAAACTTGGACATCCAGGTTCTCGAGAACCTGGATGTCCAAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-824s1c1
Sequence:CCGGCCACACGCTCTACTACTTTCTCTCGAGAGAAAGTAGTAGAGCGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145804.1-3646s1c1
Sequence:CCGGCGGCTCCTTTAATGTAGGATTCTCGAGAATCCTACATTAAAGGAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-2531s1c1
Sequence:CCGGGAACACCTACAAATATGCCAACTCGAGTTGGCATATTTGTAGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145804.1-2039s1c1
Sequence:CCGGGCTCATGTTCGACATCCTCAACTCGAGTTGAGGATGTCGAACATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145804.1-2914s1c1
Sequence:CCGGGCCCTAGAGCTGTTTGTTCAACTCGAGTTGAACAAACAGCTCTAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145804.1-3108s1c1
Sequence:CCGGGCCTCAGTAAACTCAGACCATCTCGAGATGGTCTGAGTTTACTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-1064s1c1
Sequence:CCGGGCTCAAACCCGAACACTGTTTCTCGAGAAACAGTGTTCGGGTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145804
VALIDATED
ABTB2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and BTB (POZ) domain containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-823s21c1
Sequence:CCGGTCCACACGCTCTACTACTTTCCTCGAGGAAAGTAGTAGAGCGTGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-2914s21c1
Sequence:CCGGGCCCTAGAGCTGTTTGTTCAACTCGAGTTGAACAAACAGCTCTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145804.1-2344s21c1
Sequence:CCGGGCGACATGAAGTACCACATTTCTCGAGAAATGTGGTACTTCATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145804.1-2525s21c1
Sequence:CCGGTGCCGTGAACACCTACAAATACTCGAGTATTTGTAGGTGTTCACGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_145804.1-2284s21c1
Sequence:CCGGAGACACTAATGACCAATAAATCTCGAGATTTATTGGTCATTAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145804.1-1308s1c1
Sequence:CCGGGCAAACTTGGACATCCAGGTTCTCGAGAACCTGGATGTCCAAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-824s1c1
Sequence:CCGGCCACACGCTCTACTACTTTCTCTCGAGAGAAAGTAGTAGAGCGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145804.1-3646s1c1
Sequence:CCGGCGGCTCCTTTAATGTAGGATTCTCGAGAATCCTACATTAAAGGAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-2531s1c1
Sequence:CCGGGAACACCTACAAATATGCCAACTCGAGTTGGCATATTTGTAGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145804.1-2039s1c1
Sequence:CCGGGCTCATGTTCGACATCCTCAACTCGAGTTGAGGATGTCGAACATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_145804.1-2914s1c1
Sequence:CCGGGCCCTAGAGCTGTTTGTTCAACTCGAGTTGAACAAACAGCTCTAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145804.1-3108s1c1
Sequence:CCGGGCCTCAGTAAACTCAGACCATCTCGAGATGGTCTGAGTTTACTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145804.1-1064s1c1
Sequence:CCGGGCTCAAACCCGAACACTGTTTCTCGAGAAACAGTGTTCGGGTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178890
ABTB2 MISSION shRNA Bacterial Glycerol Stock
ankyrin repeat and BTB (POZ) domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.3-3266s1c1
Sequence:CCGGGTGCTGTCAACACCTACAAATCTCGAGATTTGTAGGTGTTGACAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178890.3-4350s21c1
Sequence:CCGGGCTACCTTAGAAACTATTTATCTCGAGATAAATAGTTTCTAAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-2042s21c1
Sequence:CCGGTTGATGCTGGAGCTAACTTAGCTCGAGCTAAGTTAGCTCCAGCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-1319s21c1
Sequence:CCGGCCTACTTCAGTCCCTACAATGCTCGAGCATTGTAGGGACTGAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-3266s21c1
Sequence:CCGGGTGCTGTCAACACCTACAAATCTCGAGATTTGTAGGTGTTGACAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-2119s21c1
Sequence:CCGGCATTGGACCTCCCTGACATTTCTCGAGAAATGTCAGGGAGGTCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178890.3-4102s1c1
Sequence:CCGGGCCAAAGTGAAGAGGTTGGTTCTCGAGAACCAACCTCTTCACTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.2-522s1c1
Sequence:CCGGGACAGCATCAAGAACAGCTACCTCGAGGTAGCTGTTCTTGATGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.2-530s1c1
Sequence:CCGGCAAGAACAGCTACCTTAGAAACTCGAGTTTCTAAGGTAGCTGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178890
ABTB2 MISSION shRNA shRNA Plasmid DNA
ankyrin repeat and BTB (POZ) domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.3-3266s1c1
Sequence:CCGGGTGCTGTCAACACCTACAAATCTCGAGATTTGTAGGTGTTGACAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178890.3-4350s21c1
Sequence:CCGGGCTACCTTAGAAACTATTTATCTCGAGATAAATAGTTTCTAAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-2042s21c1
Sequence:CCGGTTGATGCTGGAGCTAACTTAGCTCGAGCTAAGTTAGCTCCAGCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-1319s21c1
Sequence:CCGGCCTACTTCAGTCCCTACAATGCTCGAGCATTGTAGGGACTGAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-3266s21c1
Sequence:CCGGGTGCTGTCAACACCTACAAATCTCGAGATTTGTAGGTGTTGACAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-2119s21c1
Sequence:CCGGCATTGGACCTCCCTGACATTTCTCGAGAAATGTCAGGGAGGTCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178890.3-4102s1c1
Sequence:CCGGGCCAAAGTGAAGAGGTTGGTTCTCGAGAACCAACCTCTTCACTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.2-522s1c1
Sequence:CCGGGACAGCATCAAGAACAGCTACCTCGAGGTAGCTGTTCTTGATGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.2-530s1c1
Sequence:CCGGCAAGAACAGCTACCTTAGAAACTCGAGTTTCTAAGGTAGCTGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178890
ABTB2 MISSION shRNA Lentiviral Transduction Particles
ankyrin repeat and BTB (POZ) domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.3-3266s1c1
Sequence:CCGGGTGCTGTCAACACCTACAAATCTCGAGATTTGTAGGTGTTGACAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178890.3-4350s21c1
Sequence:CCGGGCTACCTTAGAAACTATTTATCTCGAGATAAATAGTTTCTAAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-2042s21c1
Sequence:CCGGTTGATGCTGGAGCTAACTTAGCTCGAGCTAAGTTAGCTCCAGCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-1319s21c1
Sequence:CCGGCCTACTTCAGTCCCTACAATGCTCGAGCATTGTAGGGACTGAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-3266s21c1
Sequence:CCGGGTGCTGTCAACACCTACAAATCTCGAGATTTGTAGGTGTTGACAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178890.3-2119s21c1
Sequence:CCGGCATTGGACCTCCCTGACATTTCTCGAGAAATGTCAGGGAGGTCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201790    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178890.3-4102s1c1
Sequence:CCGGGCCAAAGTGAAGAGGTTGGTTCTCGAGAACCAACCTCTTCACTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.2-522s1c1
Sequence:CCGGGACAGCATCAAGAACAGCTACCTCGAGGTAGCTGTTCTTGATGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178890.2-530s1c1
Sequence:CCGGCAAGAACAGCTACCTTAGAAACTCGAGTTTCTAAGGTAGCTGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)