EMAIL THIS PAGE TO A FRIEND

Acaa1a

10 Gene Product Result for
Gene ID:
Rat(24157) acetyl-CoA acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091241 MISSION® esiRNA targeting mouse Acaa1a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012489 Rosetta Predictions rat pricing
NM_130864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069427 predicted 357
2 SASI_Rn01_00069428 predicted 349
3 SASI_Rn01_00069429 predicted 349
4 SASI_Rn02_00259516 predicted 554
5 SASI_Rn01_00069430 predicted 1503
6 SASI_Rn01_00069431 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141664 predicted 526
2 SASI_Mm01_00141665 predicted 476
3 SASI_Mm01_00141666 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130864
VALIDATED
Acaa1a MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.2-1235s1c1
Sequence:CCGGCATAGACATCTTTGAGATCAACTCGAGTTGATCTCAAAGATGTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-627s21c1
Sequence:CCGGGGCATCAGAAATGGGTCTTATCTCGAGATAAGACCCATTTCTGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-479s21c1
Sequence:CCGGCTCCGTGGGCAATGTTCTTGACTCGAGTCAAGAACATTGCCCACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130864.2-1601s1c1
Sequence:CCGGCACAGCACTTTACTTTAGAAACTCGAGTTTCTAAAGTAAAGTGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.2-1227s1c1
Sequence:CCGGGTGAATGACATAGACATCTTTCTCGAGAAAGATGTCTATGTCATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.3-627s1c1
Sequence:CCGGGGCATCAGAAATGGGTCTTATCTCGAGATAAGACCCATTTCTGATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130864.3-520s21c1
Sequence:CCGGTGGCACGCATCGCCCAATTTCCTCGAGGAAATTGGGCGATGCGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-1601s21c1
Sequence:CCGGCACAGCACTTTACTTTAGAAACTCGAGTTTCTAAAGTAAAGTGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-1237s21c1
Sequence:CCGGTAGACATCTTTGAGATCAATGCTCGAGCATTGATCTCAAAGATGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130864
VALIDATED
Acaa1a MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.2-1235s1c1
Sequence:CCGGCATAGACATCTTTGAGATCAACTCGAGTTGATCTCAAAGATGTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-627s21c1
Sequence:CCGGGGCATCAGAAATGGGTCTTATCTCGAGATAAGACCCATTTCTGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-479s21c1
Sequence:CCGGCTCCGTGGGCAATGTTCTTGACTCGAGTCAAGAACATTGCCCACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130864.2-1601s1c1
Sequence:CCGGCACAGCACTTTACTTTAGAAACTCGAGTTTCTAAAGTAAAGTGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.2-1227s1c1
Sequence:CCGGGTGAATGACATAGACATCTTTCTCGAGAAAGATGTCTATGTCATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.3-627s1c1
Sequence:CCGGGGCATCAGAAATGGGTCTTATCTCGAGATAAGACCCATTTCTGATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130864.3-520s21c1
Sequence:CCGGTGGCACGCATCGCCCAATTTCCTCGAGGAAATTGGGCGATGCGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-1601s21c1
Sequence:CCGGCACAGCACTTTACTTTAGAAACTCGAGTTTCTAAAGTAAAGTGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-1237s21c1
Sequence:CCGGTAGACATCTTTGAGATCAATGCTCGAGCATTGATCTCAAAGATGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130864
VALIDATED
Acaa1a MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.2-1235s1c1
Sequence:CCGGCATAGACATCTTTGAGATCAACTCGAGTTGATCTCAAAGATGTCTATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000246455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-627s21c1
Sequence:CCGGGGCATCAGAAATGGGTCTTATCTCGAGATAAGACCCATTTCTGATGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000246459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-479s21c1
Sequence:CCGGCTCCGTGGGCAATGTTCTTGACTCGAGTCAAGAACATTGCCCACGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183781    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130864.2-1601s1c1
Sequence:CCGGCACAGCACTTTACTTTAGAAACTCGAGTTTCTAAAGTAAAGTGCTGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.2-1227s1c1
Sequence:CCGGGTGAATGACATAGACATCTTTCTCGAGAAAGATGTCTATGTCATTCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130864.3-627s1c1
Sequence:CCGGGGCATCAGAAATGGGTCTTATCTCGAGATAAGACCCATTTCTGATGCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000246456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130864.3-520s21c1
Sequence:CCGGTGGCACGCATCGCCCAATTTCCTCGAGGAAATTGGGCGATGCGTGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000246457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-1601s21c1
Sequence:CCGGCACAGCACTTTACTTTAGAAACTCGAGTTTCTAAAGTAAAGTGCTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000246458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_130864.3-1237s21c1
Sequence:CCGGTAGACATCTTTGAGATCAATGCTCGAGCATTGATCTCAAAGATGTCTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???