EMAIL THIS PAGE TO A FRIEND

Acaa1b

30 Gene Product Result for
Gene ID:
Rat(501072) acetyl-Coenzyme A acyltransferase 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092601 MISSION® esiRNA targeting mouse Acaa1b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040019 Rosetta Predictions rat pricing
XM_001062085 Rosetta Predictions rat pricing
XM_001077387 Rosetta Predictions rat pricing
NM_146230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035735 predicted 326
2 SASI_Rn01_00035736 predicted 320
3 SASI_Rn01_00035737 predicted 502
4 SASI_Rn01_00035738 predicted 272
5 SASI_Rn01_00035739 predicted 267
6 SASI_Rn01_00035740 predicted 1521
7 SASI_Rn01_00035741 predicted 1397
8 SASI_Rn01_00035742 predicted 1443
9 SASI_Rn01_00035743 predicted 1499
10 SASI_Rn01_00035744 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302377 predicted 351
2 SASI_Rn02_00302378 predicted 332
3 SASI_Rn02_00302379 predicted 288
4 SASI_Rn02_00302380 predicted 286
5 SASI_Rn02_00302381 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356886 predicted 348
2 SASI_Rn02_00356887 predicted 334
3 SASI_Rn02_00356888 predicted 525
4 SASI_Rn02_00356889 predicted 282
5 SASI_Rn02_00356890 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068774 predicted 408
2 SASI_Mm01_00068775 predicted 563
3 SASI_Mm01_00068776 predicted 1562
4 SASI_Mm01_00068777 predicted 1630
5 SASI_Mm01_00068778 predicted 1562
6 SASI_Mm01_00068779 predicted 1544
7 SASI_Mm01_00068780 predicted 1630
8 SASI_Mm01_00068781 predicted 1539
9 SASI_Mm01_00068782 predicted 1570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146230
Acaa1b MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-1256s21c1
Sequence:CCGGAGGTTGTCACGCTACTCAATGCTCGAGCATTGAGTAGCGTGACAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-506s21c1
Sequence:CCGGGCATCAGAAATGGGTCTTATGCTCGAGCATAAGACCCATTTCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-572s21c1
Sequence:CCGGGAGGGAACCATGGGAATATTTCTCGAGAAATATTCCCATGGTTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-1097s21c1
Sequence:CCGGGGCTGACTGTGAATGACATAGCTCGAGCTATGTCATTCACAGTCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146230.3-1475s21c1
Sequence:CCGGGTGTCACAGCACTTTAATTTACTCGAGTAAATTAAAGTGCTGTGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146230
Acaa1b MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-1256s21c1
Sequence:CCGGAGGTTGTCACGCTACTCAATGCTCGAGCATTGAGTAGCGTGACAACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000248122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-506s21c1
Sequence:CCGGGCATCAGAAATGGGTCTTATGCTCGAGCATAAGACCCATTTCTGATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000248124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-572s21c1
Sequence:CCGGGAGGGAACCATGGGAATATTTCTCGAGAAATATTCCCATGGTTCCCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000248123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-1097s21c1
Sequence:CCGGGGCTGACTGTGAATGACATAGCTCGAGCTATGTCATTCACAGTCAGCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000248121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146230.3-1475s21c1
Sequence:CCGGGTGTCACAGCACTTTAATTTACTCGAGTAAATTAAAGTGCTGTGACACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146230
Acaa1b MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-1256s21c1
Sequence:CCGGAGGTTGTCACGCTACTCAATGCTCGAGCATTGAGTAGCGTGACAACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-506s21c1
Sequence:CCGGGCATCAGAAATGGGTCTTATGCTCGAGCATAAGACCCATTTCTGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-572s21c1
Sequence:CCGGGAGGGAACCATGGGAATATTTCTCGAGAAATATTCCCATGGTTCCCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146230.3-1097s21c1
Sequence:CCGGGGCTGACTGTGAATGACATAGCTCGAGCTATGTCATTCACAGTCAGCCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146230.3-1475s21c1
Sequence:CCGGGTGTCACAGCACTTTAATTTACTCGAGTAAATTAAAGTGCTGTGACACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???