EMAIL THIS PAGE TO A FRIEND

ACAN

aggrecan

117 Gene Product Result for
Synonyms: AGC1 AGCAN CSPG1 CSPGCP MSK16 SEDK
UniProtKB ID: P16112, Q13650, Q9UCD3, Q9UCP4, Q9UCP5, Q9UDE0
Gene ID:
Human(176) Summary: This gene is a member of the aggrecan/versican proteoglycan family. The encoded protein is an integral part of the extracellular matrix in cartilagenous tissue and it withstands compression in cartilage. Mutations in this gene may be involved in skeletal dysplasia and spinal degeneration. Multiple alternatively spliced transcript variants that encode different protein isoforms have been observed in this gene. [provided by RefSeq, Jul 2008]
Mouse(11595) aggrecan
Rat(58968) aggrecan
chicken(395798) aggrecan
cow(280985) aggrecan
Horse(100033876) aggrecan
dog(403828) aggrecan
sheep(443001) aggrecan
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038241 Anti-ACAN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunohistochemistry pricing
HPA038242 Anti-ACAN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody Antibody Enhanced Validation human
immunohistochemistry pricing
SAB4500662 Anti-Aggrecan (Cleaved-Asp369), N-Terminal antibody produced in rabbit affinity isolated antibody rat, human
ELISA, immunohistochemistry, western blot pricing
MABT110 Anti-Aggrecan (neoepitope) Antibody, clone BC-3 clone BC-3, from mouse human, bovine
immunohistochemistry, western blot pricing
AB1031 Anti-Aggrecan Antibody clone, Chemicon®, from rabbit mouse, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MABT153 Anti-Aggrecan Antibody (full length), clone 4D7.1 clone 4D7.1, 1 mg/mL, from mouse human
western blot pricing
MABT83 Anti-Aggrecan Antibody, clone 6B4 clone 6B4, from mouse bovine, bovine, human
immunohistochemistry, western blot pricing
MAB19310-C Anti-Aggrecan Antibody, MMP Cleaved, clone AF-28, Ascites Free clone AF-28, from mouse human, rat, mouse, porcine, bovine, porcine, mouse, rat, bovine, human
immunohistochemistry, western blot pricing
MAB19310 Anti-Aggrecan Antibody, MMP Cleaved, NT FFGVG neoepitopes, clone AF-28 clone AF-28, Chemicon®, from mouse bovine, human, rat, mouse, pig
ELISA, western blot pricing
MAB2015 Anti-Cartilage Proteoglycan Antibody, adult, clone EFG-4 ascites fluid, clone EFG-4, Chemicon® chicken, rabbit, sheep, bovine, pig, canine, human
ELISA, immunohistochemistry, radioimmunoassay, western blot pricing
MAB2010 Anti-Cartilage Proteoglycan Antibody, fetal, clone HFPG-846 ascites fluid, clone HFPG-846, Chemicon® human
ELISA, immunohistochemistry, radioimmunoassay, western blot pricing
MAB2035 Anti-Chondroitin 6 Sulfate Antibody, clone MK-302 ascites fluid, clone MK-302, Chemicon® human, mouse, sheep, bovine, canine, rat, rabbit
ELISA, radioimmunoassay, western blot pricing
MAB5284 Anti-Chondroitin Sulfate Proteoglycan Antibody, Brain (core protein), clone Cat-301 clone Cat-301, Chemicon®, from mouse feline, hamster, rat, human, guinea pig, gerbil, primate
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB1581 Anti-Chondroitin Sulfate Proteoglycan Antibody, Core Protein Epitope, clone Cat-315 ascites fluid, clone Cat-315, Chemicon® feline, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
AB1033 Anti-Versican Antibody, a.a. 1360-1439 of mouse versican clone, Chemicon®, from rabbit mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
C8035 Monoclonal Anti-Chondroitin Sulfate antibody produced in mouse clone CS-56, ascites fluid chicken, human, bovine, rabbit, pig, rat, mouse
immunofluorescence, microarray pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001135 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001135 Rosetta Predictions human pricing
NM_013227 Rosetta Predictions human pricing
NM_022190 Rosetta Predictions rat pricing
NM_007424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074523 predicted 4835
2 SASI_Hs01_00074525 predicted 4843
3 SASI_Hs01_00074526 predicted 1091
4 SASI_Hs01_00074527 predicted 2064
5 SASI_Hs02_00331223 predicted 6153
6 SASI_Hs01_00074529 predicted 4542
7 SASI_Hs01_00074530 predicted 5350
8 SASI_Hs01_00074531 predicted 5704
9 SASI_Hs01_00074532 predicted 5001
10 SASI_Hs02_00331224 predicted 664
11 SASI_Hs01_00074524 predicted 2351
12 SASI_Hs01_00074528 predicted 2569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081154 predicted 4828
2 SASI_Hs01_00081156 predicted 4844
3 SASI_Hs01_00081157 predicted 1093
4 SASI_Hs01_00081158 predicted 2069
5 SASI_Hs02_00344409 predicted 6157
6 SASI_Hs01_00081160 predicted 4545
7 SASI_Hs01_00081161 predicted 5353
8 SASI_Hs01_00081162 predicted 5701
9 SASI_Hs01_00081163 predicted 4996
10 SASI_Hs02_00344410 predicted 662
11 SASI_Hs01_00081155 predicted 2350
12 SASI_Hs01_00081159 predicted 2566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057662 predicted 668
2 SASI_Rn01_00057664 predicted 1876
3 SASI_Rn01_00057666 predicted 4529
4 SASI_Rn01_00057667 predicted 5308
5 SASI_Rn01_00057668 predicted 5809
6 SASI_Rn01_00057669 predicted 4105
7 SASI_Rn02_00262936 predicted 4532
8 SASI_Rn01_00057670 predicted 5034
9 SASI_Rn02_00262937 predicted 1569
10 SASI_Rn01_00057671 predicted 3333
11 SASI_Rn01_00057663 predicted 6488
12 SASI_Rn01_00057665 predicted 5950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167730 predicted 578
2 SASI_Mm02_00311572 predicted 5909
3 SASI_Mm01_00167731 predicted 1103
4 SASI_Mm01_00167732 predicted 4989
5 SASI_Mm01_00167733 predicted 848
6 SASI_Mm01_00167734 predicted 2093
7 SASI_Mm01_00167735 predicted 5166
8 SASI_Mm01_00167736 predicted 599
9 SASI_Mm01_00167737 predicted 5742
10 SASI_Mm01_00167738 predicted 3867
11 SASI_Mm01_00167739 predicted 5213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007424
ACAN MISSION shRNA Bacterial Glycerol Stock
aggrecan
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007424.2-6627s21c1
Sequence:CCGGGTCATATAAGGAATCCATTAACTCGAGTTAATGGATTCCTTATATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007424.2-2312s21c1
Sequence:CCGGACAACAGAAGTGCCATATTTCCTCGAGGAAATATGGCACTTCTGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-3869s1c1
Sequence:CCGGCTGGATTTAGTGGTGAGTATTCTCGAGAATACTCACCACTAAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-6069s1c1
Sequence:CCGGCGGTCTGAATGACAGGACTATCTCGAGATAGTCCTGTCATTCAGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-1843s1c1
Sequence:CCGGCCATCATCAGAAACCTATGATCTCGAGATCATAGGTTTCTGATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-571s1c1
Sequence:CCGGGAGGTCATAGTGAAAGGTATTCTCGAGAATACCTTTCACTATGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-5546s1c1
Sequence:CCGGCGGAAGTGAGTGGAGAATCTACTCGAGTAGATTCTCCACTCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007424
ACAN MISSION shRNA shRNA Plasmid DNA
aggrecan
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007424.2-6627s21c1
Sequence:CCGGGTCATATAAGGAATCCATTAACTCGAGTTAATGGATTCCTTATATGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000453266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007424.2-2312s21c1
Sequence:CCGGACAACAGAAGTGCCATATTTCCTCGAGGAAATATGGCACTTCTGTTGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-3869s1c1
Sequence:CCGGCTGGATTTAGTGGTGAGTATTCTCGAGAATACTCACCACTAAATCCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-6069s1c1
Sequence:CCGGCGGTCTGAATGACAGGACTATCTCGAGATAGTCCTGTCATTCAGACCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-1843s1c1
Sequence:CCGGCCATCATCAGAAACCTATGATCTCGAGATCATAGGTTTCTGATGATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-571s1c1
Sequence:CCGGGAGGTCATAGTGAAAGGTATTCTCGAGAATACCTTTCACTATGACCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-5546s1c1
Sequence:CCGGCGGAAGTGAGTGGAGAATCTACTCGAGTAGATTCTCCACTCACTTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007424
ACAN MISSION shRNA Lentiviral Transduction Particles
aggrecan
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007424.2-6627s21c1
Sequence:CCGGGTCATATAAGGAATCCATTAACTCGAGTTAATGGATTCCTTATATGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000453266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007424.2-2312s21c1
Sequence:CCGGACAACAGAAGTGCCATATTTCCTCGAGGAAATATGGCACTTCTGTTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-3869s1c1
Sequence:CCGGCTGGATTTAGTGGTGAGTATTCTCGAGAATACTCACCACTAAATCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-6069s1c1
Sequence:CCGGCGGTCTGAATGACAGGACTATCTCGAGATAGTCCTGTCATTCAGACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-1843s1c1
Sequence:CCGGCCATCATCAGAAACCTATGATCTCGAGATCATAGGTTTCTGATGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-571s1c1
Sequence:CCGGGAGGTCATAGTGAAAGGTATTCTCGAGAATACCTTTCACTATGACCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000071729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007424.1-5546s1c1
Sequence:CCGGCGGAAGTGAGTGGAGAATCTACTCGAGTAGATTCTCCACTCACTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001135
VALIDATED
ACAN MISSION shRNA Bacterial Glycerol Stock
aggrecan
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-5486s1c1
Sequence:CCGGGCAGTGGAACTCCATCTAGTTCTCGAGAACTAGATGGAGTTCCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5854s1c1
Sequence:CCGGGAACCAACTATTTCTCAGGAACTCGAGTTCCTGAGAAATAGTTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-4684s1c1
Sequence:CCGGCCAACTGTTTCCCTAGTGGATCTCGAGATCCACTAGGGAAACAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-4672s1c1
Sequence:CCGGCCATCTGGATTCCCAACTGTTCTCGAGAACAGTTGGGAATCCAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-508s1c1
Sequence:CCGGGTGAAAGGCATCGTGTTCCATCTCGAGATGGAACACGATGCCTTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-1744s1c1
Sequence:CCGGCCATCAACAGAGACCTACGATCTCGAGATCGTAGGTCTCTGTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5857s1c1
Sequence:CCGGCCAACTATTTCTCAGGAACTACTCGAGTAGTTCCTGAGAAATAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5750s1c1
Sequence:CCGGCCAATGTAAGTGGAGAATCCTCTCGAGAGGATTCTCCACTTACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-519s1c1
Sequence:CCGGCGTGTTCCATTACAGAGCCATCTCGAGATGGCTCTGTAATGGAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001135
VALIDATED
ACAN MISSION shRNA shRNA Plasmid DNA
aggrecan
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-5486s1c1
Sequence:CCGGGCAGTGGAACTCCATCTAGTTCTCGAGAACTAGATGGAGTTCCACTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000158785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5854s1c1
Sequence:CCGGGAACCAACTATTTCTCAGGAACTCGAGTTCCTGAGAAATAGTTGGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000164461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-4684s1c1
Sequence:CCGGCCAACTGTTTCCCTAGTGGATCTCGAGATCCACTAGGGAAACAGTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000164010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-4672s1c1
Sequence:CCGGCCATCTGGATTCCCAACTGTTCTCGAGAACAGTTGGGAATCCAGATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000163653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-508s1c1
Sequence:CCGGGTGAAAGGCATCGTGTTCCATCTCGAGATGGAACACGATGCCTTTCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000162857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-1744s1c1
Sequence:CCGGCCATCAACAGAGACCTACGATCTCGAGATCGTAGGTCTCTGTTGATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000160486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5857s1c1
Sequence:CCGGCCAACTATTTCTCAGGAACTACTCGAGTAGTTCCTGAGAAATAGTTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000162135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5750s1c1
Sequence:CCGGCCAATGTAAGTGGAGAATCCTCTCGAGAGGATTCTCCACTTACATTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000164081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-519s1c1
Sequence:CCGGCGTGTTCCATTACAGAGCCATCTCGAGATGGCTCTGTAATGGAACACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001135
VALIDATED
ACAN MISSION shRNA Lentiviral Transduction Particles
aggrecan
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-5486s1c1
Sequence:CCGGGCAGTGGAACTCCATCTAGTTCTCGAGAACTAGATGGAGTTCCACTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5854s1c1
Sequence:CCGGGAACCAACTATTTCTCAGGAACTCGAGTTCCTGAGAAATAGTTGGTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-4684s1c1
Sequence:CCGGCCAACTGTTTCCCTAGTGGATCTCGAGATCCACTAGGGAAACAGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-4672s1c1
Sequence:CCGGCCATCTGGATTCCCAACTGTTCTCGAGAACAGTTGGGAATCCAGATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000163653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-508s1c1
Sequence:CCGGGTGAAAGGCATCGTGTTCCATCTCGAGATGGAACACGATGCCTTTCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001135.1-1744s1c1
Sequence:CCGGCCATCAACAGAGACCTACGATCTCGAGATCGTAGGTCTCTGTTGATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5857s1c1
Sequence:CCGGCCAACTATTTCTCAGGAACTACTCGAGTAGTTCCTGAGAAATAGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000162135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-5750s1c1
Sequence:CCGGCCAATGTAAGTGGAGAATCCTCTCGAGAGGATTCTCCACTTACATTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000164081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001135.1-519s1c1
Sequence:CCGGCGTGTTCCATTACAGAGCCATCTCGAGATGGCTCTGTAATGGAACACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???