EMAIL THIS PAGE TO A FRIEND

ACAP2

ArfGAP with coiled-coil, ankyrin repeat and PH domains 2

177 Gene Product Result for
Synonyms: CENTB2 CNT-B2
UniProtKB ID: Q15057, A8K2V4, Q8N5Z8, Q9UQR3
Gene ID:
Mouse(78618) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Rat(619382) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
naked mole-rat(101723627) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
domestic guinea pig(100719632) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
sheep(101102615) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Domestic Rabbit(100008949) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Zebrafish(100124613) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
chicken(424895) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
domestic cat(101086169) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
cow(506187) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Horse(100069317) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
dog(488039) ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012287 Rosetta Predictions human pricing
NM_001034006 Rosetta Predictions rat pricing
NM_030138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153275 predicted 1028
2 SASI_Hs01_00153276 predicted 520
3 SASI_Hs01_00153277 predicted 829
4 SASI_Hs01_00153278 predicted 1203
5 SASI_Hs01_00153279 predicted 1312
6 SASI_Hs01_00153281 predicted 989
7 SASI_Hs02_00344030 predicted 1037
8 SASI_Hs01_00153283 predicted 308
9 SASI_Hs01_00153284 predicted 2038
10 SASI_Hs01_00153282 predicted 2162
11 SASI_Hs01_00153280 predicted 2473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092645 predicted 566
2 SASI_Rn01_00092646 predicted 802
3 SASI_Rn01_00092647 predicted 2145
4 SASI_Rn01_00092648 predicted 2057
5 SASI_Rn01_00092649 predicted 1074
6 SASI_Rn01_00092650 predicted 834
7 SASI_Rn01_00092652 predicted 1039
8 SASI_Rn01_00092653 predicted 2351
9 SASI_Rn02_00203883 predicted 540
10 SASI_Rn01_00092654 predicted 791
11 SASI_Rn01_00092651 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045093 predicted 2150
2 SASI_Mm01_00045094 predicted 519
3 SASI_Mm01_00045095 predicted 2022
4 SASI_Mm01_00045096 predicted 359
5 SASI_Mm01_00045097 predicted 734
6 SASI_Mm01_00045098 predicted 1043
7 SASI_Mm01_00045100 predicted 1639
8 SASI_Mm01_00045102 predicted 1310
9 SASI_Mm02_00336535 predicted 1025
10 SASI_Mm02_00336536 predicted 1746
11 SASI_Mm01_00045099 predicted 801
12 SASI_Mm01_00045101 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012287
VALIDATED
ACAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012287.3-3010s1c1
Sequence:CCGGCCTAGCTTTCATACACATAATCTCGAGATTATGTGTATGAAAGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-2334s1c1
Sequence:CCGGGCTGATATAGTCACCTTGTTACTCGAGTAACAAGGTGACTATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-371s1c1
Sequence:CCGGCCTGGCTCAGTATTCTAGTAACTCGAGTTACTAGAATACTGAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012287.3-1249s1c1
Sequence:CCGGCCAGTATTGCTACTGCTTATACTCGAGTATAAGCAGTAGCAATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-2457s1c1
Sequence:CCGGGCATCCAATAATCCAGAGAAACTCGAGTTTCTCTGGATTATTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012287
VALIDATED
ACAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012287.3-3010s1c1
Sequence:CCGGCCTAGCTTTCATACACATAATCTCGAGATTATGTGTATGAAAGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-2334s1c1
Sequence:CCGGGCTGATATAGTCACCTTGTTACTCGAGTAACAAGGTGACTATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-371s1c1
Sequence:CCGGCCTGGCTCAGTATTCTAGTAACTCGAGTTACTAGAATACTGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012287.3-1249s1c1
Sequence:CCGGCCAGTATTGCTACTGCTTATACTCGAGTATAAGCAGTAGCAATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-2457s1c1
Sequence:CCGGGCATCCAATAATCCAGAGAAACTCGAGTTTCTCTGGATTATTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012287
VALIDATED
ACAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012287.3-3010s1c1
Sequence:CCGGCCTAGCTTTCATACACATAATCTCGAGATTATGTGTATGAAAGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-2334s1c1
Sequence:CCGGGCTGATATAGTCACCTTGTTACTCGAGTAACAAGGTGACTATATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-371s1c1
Sequence:CCGGCCTGGCTCAGTATTCTAGTAACTCGAGTTACTAGAATACTGAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012287.3-1249s1c1
Sequence:CCGGCCAGTATTGCTACTGCTTATACTCGAGTATAAGCAGTAGCAATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012287.3-2457s1c1
Sequence:CCGGGCATCCAATAATCCAGAGAAACTCGAGTTTCTCTGGATTATTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358819
ACAP2 MISSION shRNA Bacterial Glycerol Stock
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-2014s1c1
Sequence:CCGGCTGTTGCAGAATGGTGCTAATCTCGAGATTAGCACCATTCTGCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-1468s1c1
Sequence:CCGGGCGAAATATGTGGAAAGGAAACTCGAGTTTCCTTTCCACATATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-1350s1c1
Sequence:CCGGGCTTATGTGTGAATTGGGAAACTCGAGTTTCCCAATTCACACATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358819.1-2924s1c1
Sequence:CCGGCCCACACTTTACTCTTTAGATCTCGAGATCTAAAGAGTAAAGTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358819
ACAP2 MISSION shRNA shRNA Plasmid DNA
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-2014s1c1
Sequence:CCGGCTGTTGCAGAATGGTGCTAATCTCGAGATTAGCACCATTCTGCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-1468s1c1
Sequence:CCGGGCGAAATATGTGGAAAGGAAACTCGAGTTTCCTTTCCACATATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-1350s1c1
Sequence:CCGGGCTTATGTGTGAATTGGGAAACTCGAGTTTCCCAATTCACACATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358819.1-2924s1c1
Sequence:CCGGCCCACACTTTACTCTTTAGATCTCGAGATCTAAAGAGTAAAGTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358819
ACAP2 MISSION shRNA Lentiviral Transduction Particles
ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-2014s1c1
Sequence:CCGGCTGTTGCAGAATGGTGCTAATCTCGAGATTAGCACCATTCTGCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-1468s1c1
Sequence:CCGGGCGAAATATGTGGAAAGGAAACTCGAGTTTCCTTTCCACATATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358819.1-1350s1c1
Sequence:CCGGGCTTATGTGTGAATTGGGAAACTCGAGTTTCCCAATTCACACATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358819.1-2924s1c1
Sequence:CCGGCCCACACTTTACTCTTTAGATCTCGAGATCTAAAGAGTAAAGTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)