EMAIL THIS PAGE TO A FRIEND

ACE2

angiotensin I converting enzyme 2

127 Gene Product Result for
Synonyms: ACEH
UniProtKB ID: Q9BYF1, C7ECU1, Q6UWP0, Q86WT0, Q9NRA7, Q9UFZ6
Gene ID:
Human(59272) Summary: The protein encoded by this gene belongs to the angiotensin-converting enzyme family of dipeptidyl carboxydipeptidases and has considerable homology to human angiotensin 1 converting enzyme. This secreted protein catalyzes the cleavage of angiotensin I into angiotensin 1-9, and angiotensin II into the vasodilator angiotensin 1-7. The organ- and cell-specific expression of this gene suggests that it may play a role in the regulation of cardiovascular and renal function, as well as fertility. In addition, the encoded protein is a functional receptor for the spike glycoprotein of the human coronaviruses SARS and HCoV-NL63. [provided by RefSeq, Jul 2008]
Mouse(70008) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Rat(302668) angiotensin I converting enzyme 2
Zebrafish(492331) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
cow(509235) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
domestic cat(554349) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
dog(480847) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
chicken(418623) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
sheep(101103622) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Domestic Rabbit(100327258) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
naked mole-rat(101697829) angiotensin I converting enzyme 2
domestic guinea pig(100302675) angiotensin I converting enzyme (peptidyl-dipeptidase A) 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
H4884 Hippuryl-His-Leu acetate salt human, mouse, rat pricing
F7131 N-[3-(2-Furyl)acryloyl]-Phe-Gly-Gly human, mouse, rat pricing
H1635 N-Hippuryl-His-Leu hydrate powder, ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021804 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033081 MISSION® esiRNA esiRNA human ACE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021804 Rosetta Predictions human pricing
NM_001012006 Rosetta Predictions rat pricing
XM_576956 Rosetta Predictions rat pricing
NM_001130513 Rosetta Predictions mouse pricing
NM_027286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211402 predicted 1246
2 SASI_Hs01_00211403 predicted 1987
3 SASI_Hs01_00211404 predicted 506
4 SASI_Hs01_00211405 predicted 918
5 SASI_Hs01_00211406 predicted 1824
6 SASI_Hs01_00211407 predicted 2345
7 SASI_Hs01_00211408 predicted 2010
8 SASI_Hs01_00211409 predicted 851
9 SASI_Hs01_00211410 predicted 362
10 SASI_Hs01_00211411 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037338 predicted 1179
2 SASI_Rn01_00037339 predicted 788
3 SASI_Rn01_00037340 predicted 632
4 SASI_Rn01_00037341 predicted 1555
5 SASI_Rn01_00037342 predicted 363
6 SASI_Rn01_00037343 predicted 725
7 SASI_Rn01_00037346 predicted 654
8 SASI_Rn01_00037347 predicted 822
9 SASI_Rn02_00200081 predicted 880
10 SASI_Rn02_00200082 predicted 2000
11 SASI_Rn01_00037344 predicted 435
12 SASI_Rn01_00037345 predicted 1917
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00130778 predicted 1295
2 SASI_Rn01_00130779 predicted 1653
3 SASI_Rn01_00130780 predicted 1745
4 SASI_Rn01_00130781 predicted 1585
5 SASI_Rn01_00130782 predicted 1369
6 SASI_Rn01_00130783 predicted 1491
7 SASI_Rn01_00130784 predicted 1360
8 SASI_Rn01_00130785 predicted 1646
9 SASI_Rn01_00130786 predicted 1523
10 SASI_Rn01_00130787 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311340 predicted 694
2 SASI_Mm02_00311341 predicted 2775
3 SASI_Mm02_00311342 predicted 962
4 SASI_Mm02_00311343 predicted 2239
5 SASI_Mm02_00311344 predicted 2835
6 SASI_Mm02_00311345 predicted 1114
7 SASI_Mm02_00311346 predicted 1149
8 SASI_Mm02_00311347 predicted 735
9 SASI_Mm02_00311348 predicted 1206
10 SASI_Mm02_00311349 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172370 predicted 552
2 SASI_Mm01_00172371 predicted 2628
3 SASI_Mm01_00172372 predicted 817
4 SASI_Mm01_00172373 predicted 2090
5 SASI_Mm01_00172374 predicted 2689
6 SASI_Mm01_00172375 predicted 965
7 SASI_Mm01_00172376 predicted 997
8 SASI_Mm01_00172378 predicted 585
9 SASI_Mm02_00331873 predicted 1051
10 SASI_Mm02_00331874 predicted 855
11 SASI_Mm01_00172369 predicted 1213
12 SASI_Mm01_00172377 predicted 1001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021804
ACE2 MISSION shRNA Bacterial Glycerol Stock
angiotensin I converting enzyme 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021804.2-1276s21c1
Sequence:CCGGGGGCGACTTCAGGATCCTTATCTCGAGATAAGGATCCTGAAGTCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021804.2-2557s21c1
Sequence:CCGGTTATGCCTCCATCGATATTAGCTCGAGCTAATATCGATGGAGGCATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-1870s1c1
Sequence:CCGGGCCCTTATTTACCTGGCTGAACTCGAGTTCAGCCAGGTAAATAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-341s1c1
Sequence:CCGGGCCCAAATGTATCCACTACAACTCGAGTTGTAGTGGATACATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-839s1c1
Sequence:CCGGGCAAAGTTGATGAATGCCTATCTCGAGATAGGCATTCATCAACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-209s1c1
Sequence:CCGGGCCGAAGACCTGTTCTATCAACTCGAGTTGATAGAACAGGTCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-1751s1c1
Sequence:CCGGGCTGGACAGAAACTGTTCAATCTCGAGATTGAACAGTTTCTGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021804
ACE2 MISSION shRNA shRNA Plasmid DNA
angiotensin I converting enzyme 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021804.2-1276s21c1
Sequence:CCGGGGGCGACTTCAGGATCCTTATCTCGAGATAAGGATCCTGAAGTCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021804.2-2557s21c1
Sequence:CCGGTTATGCCTCCATCGATATTAGCTCGAGCTAATATCGATGGAGGCATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-1870s1c1
Sequence:CCGGGCCCTTATTTACCTGGCTGAACTCGAGTTCAGCCAGGTAAATAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-341s1c1
Sequence:CCGGGCCCAAATGTATCCACTACAACTCGAGTTGTAGTGGATACATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-839s1c1
Sequence:CCGGGCAAAGTTGATGAATGCCTATCTCGAGATAGGCATTCATCAACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-209s1c1
Sequence:CCGGGCCGAAGACCTGTTCTATCAACTCGAGTTGATAGAACAGGTCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-1751s1c1
Sequence:CCGGGCTGGACAGAAACTGTTCAATCTCGAGATTGAACAGTTTCTGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021804
ACE2 MISSION shRNA Lentiviral Transduction Particles
angiotensin I converting enzyme 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021804.2-1276s21c1
Sequence:CCGGGGGCGACTTCAGGATCCTTATCTCGAGATAAGGATCCTGAAGTCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021804.2-2557s21c1
Sequence:CCGGTTATGCCTCCATCGATATTAGCTCGAGCTAATATCGATGGAGGCATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-1870s1c1
Sequence:CCGGGCCCTTATTTACCTGGCTGAACTCGAGTTCAGCCAGGTAAATAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-341s1c1
Sequence:CCGGGCCCAAATGTATCCACTACAACTCGAGTTGTAGTGGATACATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-839s1c1
Sequence:CCGGGCAAAGTTGATGAATGCCTATCTCGAGATAGGCATTCATCAACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-209s1c1
Sequence:CCGGGCCGAAGACCTGTTCTATCAACTCGAGTTGATAGAACAGGTCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021804.1-1751s1c1
Sequence:CCGGGCTGGACAGAAACTGTTCAATCTCGAGATTGAACAGTTTCTGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027286
ACE2 MISSION shRNA Bacterial Glycerol Stock
angiotensin I converting enzyme 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1938s1c1
Sequence:CCGGGCTCAATTACTTCCAACCGTTCTCGAGAACGGTTGGAAGTAATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1954s1c1
Sequence:CCGGCCGTTGTTTGACTGGCTGAAACTCGAGTTTCAGCCAGTCAAACAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-424s1c1
Sequence:CCGGGCCCAAAGTTTCTCACTACAACTCGAGTTGTAGTGAGAAACTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1051s1c1
Sequence:CCGGCCAAACATAGATGTTACTGATCTCGAGATCAGTAACATCTATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-457s1c1
Sequence:CCGGCCGATCATCAAGCGTCAACTACTCGAGTAGTTGACGCTTGATGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027286
ACE2 MISSION shRNA shRNA Plasmid DNA
angiotensin I converting enzyme 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1938s1c1
Sequence:CCGGGCTCAATTACTTCCAACCGTTCTCGAGAACGGTTGGAAGTAATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1954s1c1
Sequence:CCGGCCGTTGTTTGACTGGCTGAAACTCGAGTTTCAGCCAGTCAAACAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-424s1c1
Sequence:CCGGGCCCAAAGTTTCTCACTACAACTCGAGTTGTAGTGAGAAACTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1051s1c1
Sequence:CCGGCCAAACATAGATGTTACTGATCTCGAGATCAGTAACATCTATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-457s1c1
Sequence:CCGGCCGATCATCAAGCGTCAACTACTCGAGTAGTTGACGCTTGATGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027286
ACE2 MISSION shRNA Lentiviral Transduction Particles
angiotensin I converting enzyme 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1938s1c1
Sequence:CCGGGCTCAATTACTTCCAACCGTTCTCGAGAACGGTTGGAAGTAATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1954s1c1
Sequence:CCGGCCGTTGTTTGACTGGCTGAAACTCGAGTTTCAGCCAGTCAAACAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-424s1c1
Sequence:CCGGGCCCAAAGTTTCTCACTACAACTCGAGTTGTAGTGAGAAACTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-1051s1c1
Sequence:CCGGCCAAACATAGATGTTACTGATCTCGAGATCAGTAACATCTATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027286.1-457s1c1
Sequence:CCGGCCGATCATCAAGCGTCAACTACTCGAGTAGTTGACGCTTGATGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)