EMAIL THIS PAGE TO A FRIEND

ACE

angiotensin I converting enzyme

109 Gene Product Result for
Synonyms: ACE1 CD143 DCP DCP1 ICH MVCD3
Gene ID:
Human(1636) Summary: This gene encodes an enzyme involved in catalyzing the conversion of angiotensin I into a physiologically active peptide angiotensin II. Angiotensin II is a potent vasopressor and aldosterone-stimulating peptide that controls blood pressure and fluid-electrolyte balance. This enzyme plays a key role in the renin-angiotensin system. Many studies have associated the presence or absence of a 287 bp Alu repeat element in this gene with the levels of circulating enzyme or cardiovascular pathophysiologies. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, and two most abundant spliced variants encode the somatic form and the testicular form, respectively, that are equally active. [provided by RefSeq, May 2010]
Mouse(11421) angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
Rat(24310) angiotensin I converting enzyme
Zebrafish(565980) angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
cow(509484) angiotensin I converting enzyme
Horse(100064801) angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
dog(610668) angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
chicken(419953) angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
fruit fly(41625) Acetylcholine esterase
sheep(554335) angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
Domestic Rabbit(100009274) angiotensin I converting enzyme (peptidyl-dipeptidase A) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
H4884 Hippuryl-His-Leu acetate salt human, mouse, rat pricing
F7131 N-[3-(2-Furyl)acryloyl]-Phe-Gly-Gly human, mouse, rat pricing
H1635 N-Hippuryl-His-Leu hydrate powder, ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000789 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160811 MISSION® esiRNA esiRNA human ACE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000789 Rosetta Predictions human pricing
NM_152830 Rosetta Predictions human pricing
NM_152831 Rosetta Predictions human pricing
NM_012544 Rosetta Predictions rat pricing
NM_009598 Rosetta Predictions mouse pricing
NM_207624 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163816 predicted 2454
2 SASI_Hs01_00163817 predicted 2283
3 SASI_Hs01_00163818 predicted 2422
4 SASI_Hs01_00163821 predicted 3182
5 SASI_Hs01_00163822 predicted 2921
6 SASI_Hs02_00303234 predicted 3259
7 SASI_Hs01_00163824 predicted 2157
8 SASI_Hs01_00163825 predicted 2269
9 SASI_Hs02_00303235 predicted 3098
10 SASI_Hs02_00303236 predicted 2354
11 SASI_Hs01_00163819 predicted 3368
12 SASI_Hs01_00163820 predicted 2557
13 SASI_Hs01_00163823 predicted 2354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074603 predicted 770
2 SASI_Hs01_00074604 predicted 586
3 SASI_Hs01_00074605 predicted 735
4 SASI_Hs01_00074608 predicted 1496
5 SASI_Hs01_00074609 predicted 1224
6 SASI_Hs02_00366747 predicted 1565
7 SASI_Hs01_00074611 predicted 473
8 SASI_Hs01_00074612 predicted 572
9 SASI_Hs02_00366748 predicted 1406
10 SASI_Hs02_00366749 predicted 658
11 SASI_Hs01_00074606 predicted 1668
12 SASI_Hs01_00074607 predicted 871
13 SASI_Hs01_00074610 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227539 predicted 1087
2 SASI_Hs01_00227540 predicted 666
3 SASI_Hs01_00227541 predicted 473
4 SASI_Hs01_00227542 predicted 1474
5 SASI_Hs01_00227543 predicted 737
6 SASI_Hs01_00227544 predicted 284
7 SASI_Hs01_00227545 predicted 661
8 SASI_Hs01_00227546 predicted 477
9 SASI_Hs01_00227547 predicted 479
10 SASI_Hs01_00227548 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259622 predicted 2379
2 SASI_Rn01_00105157 predicted 651
3 SASI_Rn01_00105158 predicted 3776
4 SASI_Rn01_00105159 predicted 467
5 SASI_Rn01_00105160 predicted 3626
6 SASI_Rn02_00259623 predicted 453
7 SASI_Rn01_00105162 predicted 2861
8 SASI_Rn01_00105163 predicted 2988
9 SASI_Rn01_00105164 predicted 3360
10 SASI_Rn01_00105166 predicted 679
11 SASI_Rn01_00105161 predicted 2095
12 SASI_Rn01_00105165 predicted 2286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072553 predicted 517
2 SASI_Mm01_00072554 predicted 613
3 SASI_Mm01_00072555 predicted 809
4 SASI_Mm01_00072556 predicted 1217
5 SASI_Mm01_00072558 predicted 1880
6 SASI_Mm01_00072559 predicted 1600
7 SASI_Mm02_00316513 predicted 1245
8 SASI_Mm01_00072562 predicted 1935
9 SASI_Mm02_00316514 predicted 894
10 SASI_Mm02_00316515 predicted 857
11 SASI_Mm01_00072557 predicted 540
12 SASI_Mm01_00072560 predicted 614
13 SASI_Mm01_00072561 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207624 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150245 predicted 2294
2 SASI_Mm01_00150246 predicted 2393
3 SASI_Mm01_00150247 predicted 2582
4 SASI_Mm01_00150248 predicted 2995
5 SASI_Mm01_00150250 predicted 3663
6 SASI_Mm01_00150251 predicted 3374
7 SASI_Mm01_00150253 predicted 3177
8 SASI_Mm01_00150254 predicted 3710
9 SASI_Mm02_00352141 predicted 2633
10 SASI_Mm02_00352142 predicted 3181
11 SASI_Mm01_00150249 predicted 2297
12 SASI_Mm01_00150252 predicted 2378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009598
ACE MISSION shRNA Bacterial Glycerol Stock
angiotensin I converting enzyme
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-1254s1c1
Sequence:CCGGCCAGTATTTCATGCAGTACAACTCGAGTTGTACTGCATGAAATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-979s1c1
Sequence:CCGGCCCAATATAGATGCCACGGAACTCGAGTTCCGTGGCATCTATATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-569s1c1
Sequence:CCGGCCCTGGAACCTGATCTAACAACTCGAGTTGTTAGATCAGGTTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-1860s1c1
Sequence:CCGGCGCCATGATGAATTACTTCAACTCGAGTTGAAGTAATTCATCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-255s1c1
Sequence:CCGGCCAAGTGTTGTTGAACGAGTACTCGAGTACTCGTTCAACAACACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009598
ACE MISSION shRNA shRNA Plasmid DNA
angiotensin I converting enzyme
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-1254s1c1
Sequence:CCGGCCAGTATTTCATGCAGTACAACTCGAGTTGTACTGCATGAAATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-979s1c1
Sequence:CCGGCCCAATATAGATGCCACGGAACTCGAGTTCCGTGGCATCTATATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-569s1c1
Sequence:CCGGCCCTGGAACCTGATCTAACAACTCGAGTTGTTAGATCAGGTTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-1860s1c1
Sequence:CCGGCGCCATGATGAATTACTTCAACTCGAGTTGAAGTAATTCATCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-255s1c1
Sequence:CCGGCCAAGTGTTGTTGAACGAGTACTCGAGTACTCGTTCAACAACACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009598
ACE MISSION shRNA Lentiviral Transduction Particles
angiotensin I converting enzyme
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-1254s1c1
Sequence:CCGGCCAGTATTTCATGCAGTACAACTCGAGTTGTACTGCATGAAATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-979s1c1
Sequence:CCGGCCCAATATAGATGCCACGGAACTCGAGTTCCGTGGCATCTATATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-569s1c1
Sequence:CCGGCCCTGGAACCTGATCTAACAACTCGAGTTGTTAGATCAGGTTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-1860s1c1
Sequence:CCGGCGCCATGATGAATTACTTCAACTCGAGTTGAAGTAATTCATCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009598.1-255s1c1
Sequence:CCGGCCAAGTGTTGTTGAACGAGTACTCGAGTACTCGTTCAACAACACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000789
ACE MISSION shRNA Bacterial Glycerol Stock
angiotensin I converting enzyme
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-2354s1c1
Sequence:CCGGCGGAAATATGAAGACCTGTTACTCGAGTAACAGGTCTTCATATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-3388s1c1
Sequence:CCGGCGTGCCTTACATCAGGTACTTCTCGAGAAGTACCTGATGTAAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-451s1c1
Sequence:CCGGGCTAAGCAACATGAGCAGGATCTCGAGATCCTGCTCATGTTGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-1571s1c1
Sequence:CCGGGCTAAGTTTCATGTTCCAAATCTCGAGATTTGGAACATGAAACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-1968s1c1
Sequence:CCGGCCAGCAAGTTTGTGGAGGAATCTCGAGATTCCTCCACAAACTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000789.2-622s21c1
Sequence:CCGGGAAACCGCTGTACGAGGATTTCTCGAGAAATCCTCGTACAGCGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000789.2-3156s21c1
Sequence:CCGGACGAGCATGACATCAACTTTCCTCGAGGAAAGTTGATGTCATGCTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000789
ACE MISSION shRNA shRNA Plasmid DNA
angiotensin I converting enzyme
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-2354s1c1
Sequence:CCGGCGGAAATATGAAGACCTGTTACTCGAGTAACAGGTCTTCATATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-3388s1c1
Sequence:CCGGCGTGCCTTACATCAGGTACTTCTCGAGAAGTACCTGATGTAAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-451s1c1
Sequence:CCGGGCTAAGCAACATGAGCAGGATCTCGAGATCCTGCTCATGTTGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-1571s1c1
Sequence:CCGGGCTAAGTTTCATGTTCCAAATCTCGAGATTTGGAACATGAAACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-1968s1c1
Sequence:CCGGCCAGCAAGTTTGTGGAGGAATCTCGAGATTCCTCCACAAACTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000789.2-622s21c1
Sequence:CCGGGAAACCGCTGTACGAGGATTTCTCGAGAAATCCTCGTACAGCGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000789.2-3156s21c1
Sequence:CCGGACGAGCATGACATCAACTTTCCTCGAGGAAAGTTGATGTCATGCTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000789
ACE MISSION shRNA Lentiviral Transduction Particles
angiotensin I converting enzyme
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-2354s1c1
Sequence:CCGGCGGAAATATGAAGACCTGTTACTCGAGTAACAGGTCTTCATATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-3388s1c1
Sequence:CCGGCGTGCCTTACATCAGGTACTTCTCGAGAAGTACCTGATGTAAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-451s1c1
Sequence:CCGGGCTAAGCAACATGAGCAGGATCTCGAGATCCTGCTCATGTTGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-1571s1c1
Sequence:CCGGGCTAAGTTTCATGTTCCAAATCTCGAGATTTGGAACATGAAACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000789.2-1968s1c1
Sequence:CCGGCCAGCAAGTTTGTGGAGGAATCTCGAGATTCCTCCACAAACTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000789.2-622s21c1
Sequence:CCGGGAAACCGCTGTACGAGGATTTCTCGAGAAATCCTCGTACAGCGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000789.2-3156s21c1
Sequence:CCGGACGAGCATGACATCAACTTTCCTCGAGGAAAGTTGATGTCATGCTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)