EMAIL THIS PAGE TO A FRIEND

ACHE

acetylcholinesterase

163 Gene Product Result for
Synonyms: ACEE ARACHE N-ACHE YT
Gene ID:
Human(43) Summary: Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
Mouse(11423) acetylcholinesterase
Rat(83817) acetylcholinesterase
naked mole-rat(101705724) acetylcholinesterase
domestic guinea pig(100422792) acetylcholinesterase
sheep(101123006) acetylcholinesterase
Zebrafish(114549) acetylcholinesterase
cow(540446) acetylcholinesterase
domestic cat(493674) acetylcholinesterase
dog(489828) acetylcholinesterase
chicken(396388) acetylcholinesterase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500018 Anti-ACHE antibody produced in goat affinity isolated antibody, buffered aqueous solution cat, human, rabbit, mouse, rat
ELISA, western blot pricing
SAB2108350 Anti-ACHE antibody produced in rabbit affinity isolated antibody guinea pig, human, rabbit, horse
western blot pricing
HPA019704 Anti-ACHE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2105119 Anti-ACHE antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, human, rabbit
western blot pricing
SAB1410788 Anti-ACHE antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA027098 Anti-ACHE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2104962 Anti-ACHE, (N-terminal) antibody produced in rabbit affinity isolated antibody sheep, human, horse, rabbit, rat, mouse, guinea pig
western blot pricing
A6970 Monoclonal Anti-Acetylcholinesterase antibody produced in mouse clone ZR3, purified immunoglobulin, buffered aqueous solution rabbit, rat, guinea pig, feline
immunohistochemistry, immunoprecipitation (IP) pricing
WH0000043M2 Monoclonal Anti-ACHE antibody produced in mouse clone 2C3, purified immunoglobulin, buffered aqueous solution mouse, human
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M100 (−)-N-Methylphysostigmine analytical standard, for drug analysis human pricing
C101400 1,2-Cyclohexanedione 97% human pricing
29059 1,3-Cyclohexanedione purum, for fluorescence, ≥97.0% (T) human pricing
C101605 1,3-Cyclohexanedione 97% human pricing
D33454 1,3-Diphenyl-1,3-propanedione 98% human pricing
A9013 1,5-Bis(4-allyldimethylammoniumphenyl)pentan-3-one dibromide human pricing
223034 1-Phenyl-1,2-propanedione 99% human pricing
W322601 1-Phenyl-1,2-propanedione 98%, FG human pricing
630012 2,2′-Dichlorobenzil 97% human pricing
P57409 2,2′-Pyridil 97% human pricing
454389 2,2′-Thenil 98% human pricing
196118 2,2-Dimethoxy-2-phenylacetophenone 99% human pricing
11038 2,3-Butanedione analytical standard human pricing
B85307 2,3-Butanedione 97% human pricing
W254304 2,3-Heptanedione ≥97%, FG human pricing
241962 2,3-Pentanedione 97% human pricing
W284106 2,3-Pentanedione ≥96%, FCC, FG human pricing
W284114 2,3-Pentanedione natural, ≥96%, FG human pricing
542229 2-Chloro-3′,4′-dimethoxybenzil 97% human pricing
M37935 2-Methyl-1,3-cyclohexanedione 97% human pricing
117021 2-Methyl-1,3-cyclopentanedione 99% human pricing
P60205 2-Pyridinealdoxime methiodide 99% human pricing
381802 3,3′-Dimethoxybenzil 99% human pricing
T6601 3,4,5,6-Tetrachloro-1,2-benzoquinone 97% human pricing
157457 3,5-Di-tert-butyl-o-benzoquinone 98% human pricing
W330507 3-Methyl-1,2-cyclohexanedione ≥98%, FG human pricing
328057 4,4′-Dibromobenzil 90%, technical grade human pricing
381322 4,4′-Difluorobenzil 98% human pricing
159611 4,4′-Dimethoxybenzil 98% human pricing
A88409 4,4′-Dimethoxybenzoin 95% human pricing
146706 4,4′-Dimethylbenzil 97% human pricing
12927 4-Benzoylbenzoic acid purum, ≥98.0% (T) human pricing
B12407 4-Benzoylbenzoic acid 99% human pricing
A3773 9-Amino-1,2,3,4-tetrahydroacridine hydrochloride hydrate ≥99% human pricing
05581 Acetylacetone analytical standard human pricing
P7754 Acetylacetone ReagentPlus®, ≥99% human pricing
10916 Acetylacetone produced by Wacker Chemie AG, Burghausen, Germany, ≥99.5% (GC) human pricing
B5151 Benzil 98% human pricing
399396 Benzoin purified by sublimation, ≥99.5% human pricing
W213209 Benzoin ≥98% human pricing
B8681 Benzoin 98% human pricing
343528 Benzyl sulfone 99% human pricing
45374 Chloranil PESTANAL®, analytical standard human pricing
PS11 Chloranil analytical standard human pricing
138029 Furil 98% human pricing
192651 Furoin 98% human pricing
N2001 Neostigmine bromide ≥98% (HPLC and titration), powder human pricing
12309 p-Benzoquinone for spectrophotometric det. of amines, ≥99.5% (HPLC) human pricing
B10358 p-Benzoquinone reagent grade, ≥98% Green Alternative human pricing
P9797 Pyridostigmine bromide human pricing
S2500 Scopoletin ≥99% human pricing
232017 Tetrachloro-1,4-benzoquinone 99% human pricing
T1505 Tetraisopropyl pyrophosphoramide butyrylcholinesterase inhibitor human pricing
E8375 Eserine human, mouse, rat pricing
45710 Eserine ≥98.0% (N) human, mouse, rat pricing
T5625 (±)-α-Lipoic acid synthetic, ≥99% (titration), powder human, rat pricing
T1395 (±)-α-Lipoic acid BioReagent, cell culture tested, ≥99% human, rat pricing
62320 (±)-α-Lipoic acid ≥98.0% human, rat pricing
H5777 (±)-Huperzine A synthetic, ≥98% (TLC) human, rat pricing
H5902 (−)-Huperzine A human, rat pricing
D133 6,7-Dichloroquinoxaline-2,3-dione human, rat pricing
277738 Benzophenone-(carbonyl-13C) 99 atom % 13C human, rat pricing
M3157 Minaprine dihydrochloride analytical standard human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000665 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072891 MISSION® esiRNA esiRNA human ACHE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000665 Rosetta Predictions human pricing
NM_015831 Rosetta Predictions human pricing
NM_172009 Rosetta Predictions rat pricing
NM_009599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010946 predicted 1572
2 SASI_Hs01_00010947 predicted 1032
3 SASI_Hs01_00010948 predicted 659
4 SASI_Hs01_00010949 predicted 1499
5 SASI_Hs01_00010950 predicted 1119
6 SASI_Hs01_00010951 predicted 526
7 SASI_Hs01_00010952 predicted 439
8 SASI_Hs01_00010953 predicted 1370
9 SASI_Hs01_00010954 predicted 805
10 SASI_Hs01_00010955 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054302 predicted 1569
2 SASI_Hs01_00054303 predicted 1028
3 SASI_Hs01_00054304 predicted 658
4 SASI_Hs01_00054305 predicted 1497
5 SASI_Hs01_00054306 predicted 1121
6 SASI_Hs01_00054307 predicted 524
7 SASI_Hs01_00054308 predicted 433
8 SASI_Hs01_00054309 predicted 1378
9 SASI_Hs01_00054310 predicted 809
10 SASI_Hs01_00054311 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172009 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078749 predicted 1089
2 SASI_Rn01_00078750 predicted 371
3 SASI_Rn01_00078751 predicted 517
4 SASI_Rn01_00078752 predicted 1497
5 SASI_Rn01_00078753 predicted 318
6 SASI_Rn01_00078754 predicted 1360
7 SASI_Rn01_00078756 predicted 1554
8 SASI_Rn01_00078757 predicted 1233
9 SASI_Rn01_00078758 predicted 1795
10 SASI_Rn02_00269100 predicted 413
11 SASI_Rn01_00078755 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046497 predicted 1207
2 SASI_Mm01_00046498 predicted 433
3 SASI_Mm01_00046499 predicted 1541
4 SASI_Mm01_00046500 predicted 1777
5 SASI_Mm02_00316516 predicted 1623
6 SASI_Mm01_00046501 predicted 1473
7 SASI_Mm01_00046502 predicted 708
8 SASI_Mm01_00046503 predicted 485
9 SASI_Mm01_00046504 predicted 661
10 SASI_Mm01_00046505 predicted 1909
11 SASI_Mm01_00046506 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000665
ACHE MISSION shRNA Bacterial Glycerol Stock
acetylcholinesterase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000665.3-2044s21c1
Sequence:CCGGATTTCAGGGCTGGGCTATAACCTCGAGGTTATAGCCCAGCCCTGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000665.3-1616s21c1
Sequence:CCGGTCTCGAAACTACACGGCAGAGCTCGAGCTCTGCCGTGTAGTTTCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1470s1c1
Sequence:CCGGACGTCTTTGAACACCGTGCTTCTCGAGAAGCACGGTGTTCAAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-383s1c1
Sequence:CCGGCAGAGTGTCTGCTACCAATATCTCGAGATATTGGTAGCAGACACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-767s1c1
Sequence:CCGGCCGACATCAGTGACGCTGTTTCTCGAGAAACAGCGTCACTGATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1888s1c1
Sequence:CCGGGAAGAACCAGTTCGACCACTACTCGAGTAGTGGTCGAACTGGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1216s1c1
Sequence:CCGGCCCAGGCTTCAGCAAAGACAACTCGAGTTGTCTTTGCTGAAGCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000665
ACHE MISSION shRNA shRNA Plasmid DNA
acetylcholinesterase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000665.3-2044s21c1
Sequence:CCGGATTTCAGGGCTGGGCTATAACCTCGAGGTTATAGCCCAGCCCTGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000665.3-1616s21c1
Sequence:CCGGTCTCGAAACTACACGGCAGAGCTCGAGCTCTGCCGTGTAGTTTCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1470s1c1
Sequence:CCGGACGTCTTTGAACACCGTGCTTCTCGAGAAGCACGGTGTTCAAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-383s1c1
Sequence:CCGGCAGAGTGTCTGCTACCAATATCTCGAGATATTGGTAGCAGACACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-767s1c1
Sequence:CCGGCCGACATCAGTGACGCTGTTTCTCGAGAAACAGCGTCACTGATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1888s1c1
Sequence:CCGGGAAGAACCAGTTCGACCACTACTCGAGTAGTGGTCGAACTGGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1216s1c1
Sequence:CCGGCCCAGGCTTCAGCAAAGACAACTCGAGTTGTCTTTGCTGAAGCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000665
ACHE MISSION shRNA Lentiviral Transduction Particles
acetylcholinesterase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000665.3-2044s21c1
Sequence:CCGGATTTCAGGGCTGGGCTATAACCTCGAGGTTATAGCCCAGCCCTGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000665.3-1616s21c1
Sequence:CCGGTCTCGAAACTACACGGCAGAGCTCGAGCTCTGCCGTGTAGTTTCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1470s1c1
Sequence:CCGGACGTCTTTGAACACCGTGCTTCTCGAGAAGCACGGTGTTCAAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-383s1c1
Sequence:CCGGCAGAGTGTCTGCTACCAATATCTCGAGATATTGGTAGCAGACACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-767s1c1
Sequence:CCGGCCGACATCAGTGACGCTGTTTCTCGAGAAACAGCGTCACTGATGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1888s1c1
Sequence:CCGGGAAGAACCAGTTCGACCACTACTCGAGTAGTGGTCGAACTGGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000665.2-1216s1c1
Sequence:CCGGCCCAGGCTTCAGCAAAGACAACTCGAGTTGTCTTTGCTGAAGCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009599
ACHE MISSION shRNA Bacterial Glycerol Stock
acetylcholinesterase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-534s1c1
Sequence:CCGGCCTGTCCTCATCTGGATCTATCTCGAGATAGATCCAGATGAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1467s1c1
Sequence:CCGGCGGGTCTATGCCTACATCTTTCTCGAGAAAGATGTAGGCATAGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1061s1c1
Sequence:CCGGCCTGCCTCAAGAAAGTATCTTCTCGAGAAGATACTTTCTTGAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-777s1c1
Sequence:CCGGCCGATGTCAGTGACTCTGTTTCTCGAGAAACAGAGTCACTGACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1137s1c1
Sequence:CCGGGCTCTCATCAATACTGGAGATCTCGAGATCTCCAGTATTGATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009599
ACHE MISSION shRNA shRNA Plasmid DNA
acetylcholinesterase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-534s1c1
Sequence:CCGGCCTGTCCTCATCTGGATCTATCTCGAGATAGATCCAGATGAGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1467s1c1
Sequence:CCGGCGGGTCTATGCCTACATCTTTCTCGAGAAAGATGTAGGCATAGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1061s1c1
Sequence:CCGGCCTGCCTCAAGAAAGTATCTTCTCGAGAAGATACTTTCTTGAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-777s1c1
Sequence:CCGGCCGATGTCAGTGACTCTGTTTCTCGAGAAACAGAGTCACTGACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1137s1c1
Sequence:CCGGGCTCTCATCAATACTGGAGATCTCGAGATCTCCAGTATTGATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009599
ACHE MISSION shRNA Lentiviral Transduction Particles
acetylcholinesterase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-534s1c1
Sequence:CCGGCCTGTCCTCATCTGGATCTATCTCGAGATAGATCCAGATGAGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1467s1c1
Sequence:CCGGCGGGTCTATGCCTACATCTTTCTCGAGAAAGATGTAGGCATAGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1061s1c1
Sequence:CCGGCCTGCCTCAAGAAAGTATCTTCTCGAGAAGATACTTTCTTGAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-777s1c1
Sequence:CCGGCCGATGTCAGTGACTCTGTTTCTCGAGAAACAGAGTCACTGACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009599.2-1137s1c1
Sequence:CCGGGCTCTCATCAATACTGGAGATCTCGAGATCTCCAGTATTGATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)