EMAIL THIS PAGE TO A FRIEND

ACKR4

atypical chemokine receptor 4

88 Gene Product Result for
Synonyms: CC-CKR-11 CCBP2 CCR-11 CCR10 CCR11 CCRL1 CCX CKR CCX-CKR CKR-11 PPR1 VSHK1
Gene ID:
Human(51554) Summary: The protein encoded by this gene is a member of the G protein-coupled receptor family, and is a receptor for C-C type chemokines. This receptor has been shown to bind dendritic cell- and T cell-activated chemokines including CCL19/ELC, CCL21/SLC, and CCL25/TECK. A pseudogene of this gene is found on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2013]
Mouse(252837) atypical chemokine receptor 4
Rat(685243) atypical chemokine receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900449 Anti-CCRL1 antibody produced in rabbit affinity isolated antibody human, dog, rabbit, mouse, rat, pig, horse
immunohistochemistry pricing
SAB4502137 Anti-CCRL1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, western blot pricing
SAB4502138 Anti-CCRL1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110391 MISSION® esiRNA esiRNA human CCRL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016557 Rosetta Predictions human pricing
NM_178445 Rosetta Predictions human pricing
XM_001061561 Rosetta Predictions rat pricing
XM_001061617 Rosetta Predictions rat pricing
NM_145700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349676 predicted 427
2 SASI_Hs01_00149344 predicted 492
3 SASI_Hs01_00149345 predicted 427
4 SASI_Hs01_00149346 predicted 653
5 SASI_Hs01_00149347 predicted 460
6 SASI_Hs01_00149348 predicted 305
7 SASI_Hs01_00149349 predicted 322
8 SASI_Hs01_00149350 predicted 674
9 SASI_Hs01_00149351 predicted 267
10 SASI_Hs01_00149352 predicted 757
11 SASI_Hs01_00149353 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369674 predicted 609
2 SASI_Hs01_00122818 predicted 669
3 SASI_Hs01_00122819 predicted 606
4 SASI_Hs01_00122820 predicted 832
5 SASI_Hs01_00122821 predicted 638
6 SASI_Hs01_00122822 predicted 479
7 SASI_Hs01_00122823 predicted 495
8 SASI_Hs01_00122824 predicted 845
9 SASI_Hs01_00122825 predicted 445
10 SASI_Hs01_00122826 predicted 937
11 SASI_Hs01_00122827 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300506 predicted 321
2 SASI_Rn02_00300507 predicted 348
3 SASI_Rn02_00300508 predicted 299
4 SASI_Rn02_00300509 predicted 423
5 SASI_Rn02_00300510 predicted 654
6 SASI_Rn02_00300511 predicted 614
7 SASI_Rn02_00300512 predicted 721
8 SASI_Rn02_00300513 predicted 819
9 SASI_Rn02_00300514 predicted 217
10 SASI_Rn02_00300515 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300705 predicted 461
2 SASI_Rn02_00300706 predicted 236
3 SASI_Rn02_00300707 predicted 421
4 SASI_Rn02_00300708 predicted 771
5 SASI_Rn02_00300709 predicted 839
6 SASI_Rn02_00300710 predicted 237
7 SASI_Rn02_00300711 predicted 939
8 SASI_Rn02_00300712 predicted 755
9 SASI_Rn02_00300713 predicted 341
10 SASI_Rn02_00300714 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025899 predicted 1000
2 SASI_Mm01_00025900 predicted 1188
3 SASI_Mm01_00025901 predicted 1409
4 SASI_Mm01_00025902 predicted 965
5 SASI_Mm02_00341242 predicted 1359
6 SASI_Mm01_00025903 predicted 1165
7 SASI_Mm01_00025904 predicted 865
8 SASI_Mm01_00025905 predicted 1361
9 SASI_Mm01_00025906 predicted 1199
10 SASI_Mm01_00025907 predicted 1262
11 SASI_Mm01_00025908 predicted 857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016557
ACKR4 MISSION shRNA Bacterial Glycerol Stock
atypical chemokine receptor 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016557.2-1399s21c1
Sequence:CCGGAGAGCTTTGTGGTGATAATTTCTCGAGAAATTATCACCACAAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016557.2-803s21c1
Sequence:CCGGAGTTCTGCTCACAGTCGTTATCTCGAGATAACGACTGTGAGCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016557.2-261s21c1
Sequence:CCGGTCCATGGTAGTGGCAATTTATCTCGAGATAAATTGCCACTACCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016557.2-1386s1c1
Sequence:CCGGGCTGTAACGAAGAAGAGCTTTCTCGAGAAAGCTCTTCTTCGTTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-706s1c1
Sequence:CCGGGATTTGTAGTACCCTTTCTTACTCGAGTAAGAAAGGGTACTACAAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-142s1c1
Sequence:CCGGGCACTTATGACTACAGTCAATCTCGAGATTGACTGTAGTCATAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-212s1c1
Sequence:CCGGCCTCCCTGTATTCCTCACAATCTCGAGATTGTGAGGAATACAGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-845s1c1
Sequence:CCGGGCCTTATAACATTGTCAAGTTCTCGAGAACTTGACAATGTTATAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016557
ACKR4 MISSION shRNA shRNA Plasmid DNA
atypical chemokine receptor 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016557.2-1399s21c1
Sequence:CCGGAGAGCTTTGTGGTGATAATTTCTCGAGAAATTATCACCACAAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016557.2-803s21c1
Sequence:CCGGAGTTCTGCTCACAGTCGTTATCTCGAGATAACGACTGTGAGCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016557.2-261s21c1
Sequence:CCGGTCCATGGTAGTGGCAATTTATCTCGAGATAAATTGCCACTACCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016557.2-1386s1c1
Sequence:CCGGGCTGTAACGAAGAAGAGCTTTCTCGAGAAAGCTCTTCTTCGTTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-706s1c1
Sequence:CCGGGATTTGTAGTACCCTTTCTTACTCGAGTAAGAAAGGGTACTACAAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-142s1c1
Sequence:CCGGGCACTTATGACTACAGTCAATCTCGAGATTGACTGTAGTCATAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-212s1c1
Sequence:CCGGCCTCCCTGTATTCCTCACAATCTCGAGATTGTGAGGAATACAGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-845s1c1
Sequence:CCGGGCCTTATAACATTGTCAAGTTCTCGAGAACTTGACAATGTTATAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016557
ACKR4 MISSION shRNA Lentiviral Transduction Particles
atypical chemokine receptor 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016557.2-1399s21c1
Sequence:CCGGAGAGCTTTGTGGTGATAATTTCTCGAGAAATTATCACCACAAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016557.2-803s21c1
Sequence:CCGGAGTTCTGCTCACAGTCGTTATCTCGAGATAACGACTGTGAGCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016557.2-261s21c1
Sequence:CCGGTCCATGGTAGTGGCAATTTATCTCGAGATAAATTGCCACTACCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016557.2-1386s1c1
Sequence:CCGGGCTGTAACGAAGAAGAGCTTTCTCGAGAAAGCTCTTCTTCGTTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-706s1c1
Sequence:CCGGGATTTGTAGTACCCTTTCTTACTCGAGTAAGAAAGGGTACTACAAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-142s1c1
Sequence:CCGGGCACTTATGACTACAGTCAATCTCGAGATTGACTGTAGTCATAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-212s1c1
Sequence:CCGGCCTCCCTGTATTCCTCACAATCTCGAGATTGTGAGGAATACAGGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016557.2-845s1c1
Sequence:CCGGGCCTTATAACATTGTCAAGTTCTCGAGAACTTGACAATGTTATAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145700
ACKR4 MISSION shRNA Bacterial Glycerol Stock
atypical chemokine receptor 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000026133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1614s1c1
Sequence:CCGGCTGCGATATGAGCAAACGCATCTCGAGATGCGTTTGCTCATATCGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1193s1c1
Sequence:CCGGGCATTGACAGATATTGGGCAACTCGAGTTGCCCAATATCTGTCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1042s1c1
Sequence:CCGGGCTGTAGCAGACTTGTTACTTCTCGAGAAGTAACAAGTCTGCTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-868s1c1
Sequence:CCGGCAGTACGAAGTGATCTGCATACTCGAGTATGCAGATCACTTCGTACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145700
ACKR4 MISSION shRNA shRNA Plasmid DNA
atypical chemokine receptor 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000026133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1614s1c1
Sequence:CCGGCTGCGATATGAGCAAACGCATCTCGAGATGCGTTTGCTCATATCGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1193s1c1
Sequence:CCGGGCATTGACAGATATTGGGCAACTCGAGTTGCCCAATATCTGTCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1042s1c1
Sequence:CCGGGCTGTAGCAGACTTGTTACTTCTCGAGAAGTAACAAGTCTGCTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-868s1c1
Sequence:CCGGCAGTACGAAGTGATCTGCATACTCGAGTATGCAGATCACTTCGTACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145700
ACKR4 MISSION shRNA Lentiviral Transduction Particles
atypical chemokine receptor 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000026133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1614s1c1
Sequence:CCGGCTGCGATATGAGCAAACGCATCTCGAGATGCGTTTGCTCATATCGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1193s1c1
Sequence:CCGGGCATTGACAGATATTGGGCAACTCGAGTTGCCCAATATCTGTCAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-1042s1c1
Sequence:CCGGGCTGTAGCAGACTTGTTACTTCTCGAGAAGTAACAAGTCTGCTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145700.1-868s1c1
Sequence:CCGGCAGTACGAAGTGATCTGCATACTCGAGTATGCAGATCACTTCGTACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)