EMAIL THIS PAGE TO A FRIEND

ACMSD

aminocarboxymuconate semialdehyde decarboxylase

65 Gene Product Result for
UniProtKB ID: Q8TDX5, Q3B7X3, Q53SR5, Q96KY2
Gene ID:
Human(130013) Summary: The neuronal excitotoxin quinolinate is an intermediate in the de novo synthesis pathway of NAD from tryptophan, and has been implicated in the pathogenesis of several neurodegenerative disorders. Quinolinate is derived from alpha-amino-beta-carboxy-muconate-epsilon-semialdehyde (ACMS). ACMSD (ACMS decarboxylase; EC 4.1.1.45) can divert ACMS to a benign catabolite and thus prevent the accumulation of quinolinate from ACMS.[supplied by OMIM, Oct 2004]
Mouse(266645) amino carboxymuconate semialdehyde decarboxylase
Rat(171385) aminocarboxymuconate semialdehyde decarboxylase
Zebrafish(557166) aminocarboxymuconate semialdehyde decarboxylase
chicken(424288) aminocarboxymuconate semialdehyde decarboxylase
domestic cat(101090201) aminocarboxymuconate semialdehyde decarboxylase
cow(515030) aminocarboxymuconate semialdehyde decarboxylase
dog(476125) aminocarboxymuconate semialdehyde decarboxylase
sheep(101107168) aminocarboxymuconate semialdehyde decarboxylase
domestic guinea pig(100735977) aminocarboxymuconate semialdehyde decarboxylase
naked mole-rat(101705072) aminocarboxymuconate semialdehyde decarboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138326 Rosetta Predictions human pricing
NM_134372 Rosetta Predictions rat pricing
XM_579629 Rosetta Predictions rat pricing
NM_001033041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170533 predicted 674
2 SASI_Hs02_00363408 predicted 280
3 SASI_Hs02_00363409 predicted 264
4 SASI_Hs02_00363410 predicted 665
5 SASI_Hs01_00170535 predicted 533
6 SASI_Hs01_00170539 predicted 693
7 SASI_Hs01_00170542 predicted 987
8 SASI_Hs02_00363411 predicted 831
9 SASI_Hs02_00363412 predicted 846
10 SASI_Hs02_00363413 predicted 761
11 SASI_Hs01_00170534 predicted 912
12 SASI_Hs01_00170536 predicted 621
13 SASI_Hs01_00170537 predicted 658
14 SASI_Hs01_00170538 predicted 619
15 SASI_Hs01_00170540 predicted 1045
16 SASI_Hs01_00170541 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267935 predicted 728
2 SASI_Rn01_00079833 predicted 623
3 SASI_Rn01_00079834 predicted 493
4 SASI_Rn01_00079835 predicted 420
5 SASI_Rn02_00267936 predicted 374
6 SASI_Rn01_00079836 predicted 694
7 SASI_Rn01_00079837 predicted 696
8 SASI_Rn01_00079838 predicted 715
9 SASI_Rn01_00079839 predicted 569
10 SASI_Rn01_00079840 predicted 313
11 SASI_Rn01_00079831 predicted 704
12 SASI_Rn01_00079832 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193180 predicted 602
2 SASI_Rn01_00193181 predicted 534
3 SASI_Rn01_00193182 predicted 539
4 SASI_Rn01_00193183 predicted 691
5 SASI_Rn01_00193184 predicted 594
6 SASI_Rn01_00193185 predicted 599
7 SASI_Rn01_00193186 predicted 690
8 SASI_Rn01_00193187 predicted 541
9 SASI_Rn01_00193188 predicted 611
10 SASI_Rn01_00193189 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039515 predicted 701
2 SASI_Mm01_00039516 predicted 996
3 SASI_Mm01_00039517 predicted 465
4 SASI_Mm01_00039518 predicted 236
5 SASI_Mm01_00039519 predicted 494
6 SASI_Mm01_00039520 predicted 331
7 SASI_Mm01_00039521 predicted 895
8 SASI_Mm01_00039522 predicted 1143
9 SASI_Mm01_00039523 predicted 1104
10 SASI_Mm01_00039524 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138326
VALIDATED
ACMSD MISSION shRNA Bacterial Glycerol Stock
aminocarboxymuconate semialdehyde decarboxylase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-228s21c1
Sequence:CCGGGGGATCCAGAAGTTCGTATTACTCGAGTAATACGAACTTCTGGATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-683s21c1
Sequence:CCGGATGATCATGGGTGGAGTATTTCTCGAGAAATACTCCACCCATGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-902s21c1
Sequence:CCGGGATGTCATAGGAAAGGATAAACTCGAGTTTATCCTTTCCTATGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138326.2-1087s21c1
Sequence:CCGGACTACAAAGGCAAACTTTCAACTCGAGTTGAAAGTTTGCCTTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-657s21c1
Sequence:CCGGCAGAGACCACCATAGCCATTTCTCGAGAAATGGCTATGGTGGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138326.1-1138s1c1
Sequence:CCGGCTGAATTTACTACAAAGGCAACTCGAGTTGCCTTTGTAGTAAATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-351s1c1
Sequence:CCGGCGTATTAGAGAAATGGACCAACTCGAGTTGGTCCATTTCTCTAATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-887s1c1
Sequence:CCGGACCCGAAGAAATACCTTGGTTCTCGAGAACCAAGGTATTTCTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138326.1-961s1c1
Sequence:CCGGGATGTCATAGGAAAGGATAAACTCGAGTTTATCCTTTCCTATGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-757s1c1
Sequence:CCGGGTATTTGAGAAGTTTCCCAAACTCGAGTTTGGGAAACTTCTCAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138326
VALIDATED
ACMSD MISSION shRNA shRNA Plasmid DNA
aminocarboxymuconate semialdehyde decarboxylase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-228s21c1
Sequence:CCGGGGGATCCAGAAGTTCGTATTACTCGAGTAATACGAACTTCTGGATCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-683s21c1
Sequence:CCGGATGATCATGGGTGGAGTATTTCTCGAGAAATACTCCACCCATGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-902s21c1
Sequence:CCGGGATGTCATAGGAAAGGATAAACTCGAGTTTATCCTTTCCTATGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138326.2-1087s21c1
Sequence:CCGGACTACAAAGGCAAACTTTCAACTCGAGTTGAAAGTTTGCCTTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-657s21c1
Sequence:CCGGCAGAGACCACCATAGCCATTTCTCGAGAAATGGCTATGGTGGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138326.1-1138s1c1
Sequence:CCGGCTGAATTTACTACAAAGGCAACTCGAGTTGCCTTTGTAGTAAATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-351s1c1
Sequence:CCGGCGTATTAGAGAAATGGACCAACTCGAGTTGGTCCATTTCTCTAATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-887s1c1
Sequence:CCGGACCCGAAGAAATACCTTGGTTCTCGAGAACCAAGGTATTTCTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138326.1-961s1c1
Sequence:CCGGGATGTCATAGGAAAGGATAAACTCGAGTTTATCCTTTCCTATGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-757s1c1
Sequence:CCGGGTATTTGAGAAGTTTCCCAAACTCGAGTTTGGGAAACTTCTCAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138326
VALIDATED
ACMSD MISSION shRNA Lentiviral Transduction Particles
aminocarboxymuconate semialdehyde decarboxylase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-228s21c1
Sequence:CCGGGGGATCCAGAAGTTCGTATTACTCGAGTAATACGAACTTCTGGATCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-683s21c1
Sequence:CCGGATGATCATGGGTGGAGTATTTCTCGAGAAATACTCCACCCATGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-902s21c1
Sequence:CCGGGATGTCATAGGAAAGGATAAACTCGAGTTTATCCTTTCCTATGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138326.2-1087s21c1
Sequence:CCGGACTACAAAGGCAAACTTTCAACTCGAGTTGAAAGTTTGCCTTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138326.2-657s21c1
Sequence:CCGGCAGAGACCACCATAGCCATTTCTCGAGAAATGGCTATGGTGGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138326.1-1138s1c1
Sequence:CCGGCTGAATTTACTACAAAGGCAACTCGAGTTGCCTTTGTAGTAAATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-351s1c1
Sequence:CCGGCGTATTAGAGAAATGGACCAACTCGAGTTGGTCCATTTCTCTAATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-887s1c1
Sequence:CCGGACCCGAAGAAATACCTTGGTTCTCGAGAACCAAGGTATTTCTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138326.1-961s1c1
Sequence:CCGGGATGTCATAGGAAAGGATAAACTCGAGTTTATCCTTTCCTATGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138326.1-757s1c1
Sequence:CCGGGTATTTGAGAAGTTTCCCAAACTCGAGTTTGGGAAACTTCTCAAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033041
ACMSD MISSION shRNA Bacterial Glycerol Stock
aminocarboxymuconate semialdehyde decarboxylase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000179387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033041.1-1554s1c1
Sequence:CCGGGCCTAGTCATTCAATGGGAATCTCGAGATTCCCATTGAATGACTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-513s1c1
Sequence:CCGGCATCAACACATGGGACCTGAACTCGAGTTCAGGTCCCATGTGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-309s1c1
Sequence:CCGGCATGTTTAGCTACTGGGCCAACTCGAGTTGGCCCAGTAGCTAAACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-283s1c1
Sequence:CCGGGTCCAAGCTCTTTCCACAGTTCTCGAGAACTGTGGAAAGAGCTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033041
ACMSD MISSION shRNA shRNA Plasmid DNA
aminocarboxymuconate semialdehyde decarboxylase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000179387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033041.1-1554s1c1
Sequence:CCGGGCCTAGTCATTCAATGGGAATCTCGAGATTCCCATTGAATGACTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-513s1c1
Sequence:CCGGCATCAACACATGGGACCTGAACTCGAGTTCAGGTCCCATGTGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-309s1c1
Sequence:CCGGCATGTTTAGCTACTGGGCCAACTCGAGTTGGCCCAGTAGCTAAACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-283s1c1
Sequence:CCGGGTCCAAGCTCTTTCCACAGTTCTCGAGAACTGTGGAAAGAGCTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033041
ACMSD MISSION shRNA Lentiviral Transduction Particles
aminocarboxymuconate semialdehyde decarboxylase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000179387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033041.1-1554s1c1
Sequence:CCGGGCCTAGTCATTCAATGGGAATCTCGAGATTCCCATTGAATGACTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-513s1c1
Sequence:CCGGCATCAACACATGGGACCTGAACTCGAGTTCAGGTCCCATGTGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-309s1c1
Sequence:CCGGCATGTTTAGCTACTGGGCCAACTCGAGTTGGCCCAGTAGCTAAACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033041.1-283s1c1
Sequence:CCGGGTCCAAGCTCTTTCCACAGTTCTCGAGAACTGTGGAAAGAGCTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)