EMAIL THIS PAGE TO A FRIEND

Acnat1

64 Gene Product Result for
Gene ID:
Rat(681043) acyl-coenzyme A amino acid N-acyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU095081 MISSION® esiRNA targeting mouse Acnat1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001060051 Rosetta Predictions rat pricing
XM_131433 Rosetta Predictions mouse pricing
XM_899543 Rosetta Predictions mouse pricing
XM_908003 Rosetta Predictions mouse pricing
XM_920683 Rosetta Predictions mouse pricing
XR_002679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295202 predicted 1092
2 SASI_Rn02_00295203 predicted 1049
3 SASI_Rn02_00295204 predicted 1591
4 SASI_Rn02_00295205 predicted 1236
5 SASI_Rn02_00295206 predicted 1106
6 SASI_Rn02_00295207 predicted 1027
7 SASI_Rn02_00295208 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424414 predicted 779
2 SASI_Mm02_00424415 predicted 880
3 SASI_Mm02_00424416 predicted 844
4 SASI_Mm01_00235749 predicted 868
5 SASI_Mm01_00235751 predicted 778
6 SASI_Mm01_00235752 predicted 823
7 SASI_Mm02_00424417 predicted 780
8 SASI_Mm02_00424418 predicted 779
9 SASI_Mm01_00235753 predicted 873
10 SASI_Mm02_00424419 predicted 787
11 SASI_Mm01_00235750 predicted 964
12 SASI_Mm01_00235754 predicted 844
13 SASI_Mm01_00235755 predicted 852
14 SASI_Mm01_00235756 predicted 843
15 SASI_Mm01_00235757 predicted 974
16 SASI_Mm01_00235758 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207375 predicted 691
2 SASI_Mm02_00430018 predicted 722
3 SASI_Mm01_00207376 predicted 687
4 SASI_Mm02_00430019 predicted 791
5 SASI_Mm02_00430020 predicted 664
6 SASI_Mm01_00207378 predicted 667
7 SASI_Mm02_00430021 predicted 693
8 SASI_Mm01_00207383 predicted 827
9 SASI_Mm02_00430022 predicted 818
10 SASI_Mm02_00430023 predicted 813
11 SASI_Mm01_00207374 predicted 843
12 SASI_Mm01_00207377 predicted 856
13 SASI_Mm01_00207379 predicted 905
14 SASI_Mm01_00207380 predicted 680
15 SASI_Mm01_00207381 predicted 897
16 SASI_Mm01_00207382 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433685 predicted 867
2 SASI_Mm02_00433686 predicted 957
3 SASI_Mm02_00433687 predicted 785
4 SASI_Mm02_00433688 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_920683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442798 predicted 689
2 SASI_Mm02_00442799 predicted 681
3 SASI_Mm02_00442800 predicted 619
4 SASI_Mm02_00442801 predicted 851
5 SASI_Mm02_00442802 predicted 814
6 SASI_Mm02_00442803 predicted 366
7 SASI_Mm02_00442804 predicted 669
8 SASI_Mm02_00442805 predicted 900
9 SASI_Mm02_00442806 predicted 579
10 SASI_Mm02_00442807 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_002679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207224 predicted 875
2 SASI_Mm01_00207225 predicted 969
3 SASI_Mm01_00207226 predicted 785
4 SASI_Mm01_00207227 predicted 834
5 SASI_Mm01_00207228 predicted 877
6 SASI_Mm01_00207229 predicted 839
7 SASI_Mm01_00207230 predicted 852
8 SASI_Mm01_00207231 predicted 852
9 SASI_Mm01_00207232 predicted 976
10 SASI_Mm01_00207233 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164565
Acnat1 MISSION shRNA Bacterial Glycerol Stock
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164565.1-1486s21c1
Sequence:CCGGTCTGATATGTTCCTGATAAATCTCGAGATTTATCAGGAACATATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-754s21c1
Sequence:CCGGATTGCCACGGTCTGCATAAATCTCGAGATTTATGCAGACCGTGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-883s21c1
Sequence:CCGGTTCCGTCACACTACACAATATCTCGAGATATTGTGTAGTGTGACGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-1234s21c1
Sequence:CCGGTCCGGAAGCAAACTCTAAATACTCGAGTATTTAGAGTTTGCTTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164565.1-1294s21c1
Sequence:CCGGTGGAATTGTTGTAGGGATAAACTCGAGTTTATCCCTACAACAATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-1076s21c1
Sequence:CCGGACCTCATAGAGCCACCTTATTCTCGAGAATAAGGTGGCTCTATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-472s21c1
Sequence:CCGGGGTCCTTTCCCAGGAATTATTCTCGAGAATAATTCCTGGGAAAGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164565
Acnat1 MISSION shRNA shRNA Plasmid DNA
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164565.1-1486s21c1
Sequence:CCGGTCTGATATGTTCCTGATAAATCTCGAGATTTATCAGGAACATATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-754s21c1
Sequence:CCGGATTGCCACGGTCTGCATAAATCTCGAGATTTATGCAGACCGTGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-883s21c1
Sequence:CCGGTTCCGTCACACTACACAATATCTCGAGATATTGTGTAGTGTGACGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-1234s21c1
Sequence:CCGGTCCGGAAGCAAACTCTAAATACTCGAGTATTTAGAGTTTGCTTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164565.1-1294s21c1
Sequence:CCGGTGGAATTGTTGTAGGGATAAACTCGAGTTTATCCCTACAACAATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-1076s21c1
Sequence:CCGGACCTCATAGAGCCACCTTATTCTCGAGAATAAGGTGGCTCTATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-472s21c1
Sequence:CCGGGGTCCTTTCCCAGGAATTATTCTCGAGAATAATTCCTGGGAAAGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164565
Acnat1 MISSION shRNA Lentiviral Transduction Particles
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164565.1-1486s21c1
Sequence:CCGGTCTGATATGTTCCTGATAAATCTCGAGATTTATCAGGAACATATCAGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-754s21c1
Sequence:CCGGATTGCCACGGTCTGCATAAATCTCGAGATTTATGCAGACCGTGGCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-883s21c1
Sequence:CCGGTTCCGTCACACTACACAATATCTCGAGATATTGTGTAGTGTGACGGAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-1234s21c1
Sequence:CCGGTCCGGAAGCAAACTCTAAATACTCGAGTATTTAGAGTTTGCTTCCGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000377186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164565.1-1294s21c1
Sequence:CCGGTGGAATTGTTGTAGGGATAAACTCGAGTTTATCCCTACAACAATTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000376309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-1076s21c1
Sequence:CCGGACCTCATAGAGCCACCTTATTCTCGAGAATAAGGTGGCTCTATGAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000367185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164565.1-472s21c1
Sequence:CCGGGGTCCTTTCCCAGGAATTATTCTCGAGAATAATTCCTGGGAAAGGACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???