EMAIL THIS PAGE TO A FRIEND

Acot10

4 Gene Product Result for
Species: Mouse Acot10(64833)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU151791 MISSION® esiRNA targeting mouse Acot10 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099721 predicted 225
2 SASI_Mm01_00099722 predicted 1228
3 SASI_Mm01_00099723 predicted 450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022816
VALIDATED
Acot10 MISSION shRNA Bacterial Glycerol Stock
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-194s1c1
Sequence:CCGGCCCTTACACATCCATCAAGTTCTCGAGAACTTGATGGATGTGTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-1138s1c1
Sequence:CCGGGCCTGTTGAAGTTGGTTCATTCTCGAGAATGAACCAACTTCAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-1328s1c1
Sequence:CCGGGAGTCCATGTTGTATTTAGATCTCGAGATCTAAATACAACATGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-385s1c1
Sequence:CCGGCCCTGAACTACGAGACAAATACTCGAGTATTTGTCTCGTAGTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-490s1c1
Sequence:CCGGCCACAATCATTCTACCAATATCTCGAGATATTGGTAGAATGATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-601s1c1
Sequence:CCGGCCATGTTAGCTGGGTTGGAAACTCGAGTTTCCAACCCAGCTAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-386s1c1
Sequence:CCGGCCTGAACTACGAGACAAATATCTCGAGATATTTGTCTCGTAGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022816
VALIDATED
Acot10 MISSION shRNA shRNA Plasmid DNA
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-194s1c1
Sequence:CCGGCCCTTACACATCCATCAAGTTCTCGAGAACTTGATGGATGTGTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-1138s1c1
Sequence:CCGGGCCTGTTGAAGTTGGTTCATTCTCGAGAATGAACCAACTTCAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-1328s1c1
Sequence:CCGGGAGTCCATGTTGTATTTAGATCTCGAGATCTAAATACAACATGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-385s1c1
Sequence:CCGGCCCTGAACTACGAGACAAATACTCGAGTATTTGTCTCGTAGTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-490s1c1
Sequence:CCGGCCACAATCATTCTACCAATATCTCGAGATATTGGTAGAATGATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-601s1c1
Sequence:CCGGCCATGTTAGCTGGGTTGGAAACTCGAGTTTCCAACCCAGCTAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-386s1c1
Sequence:CCGGCCTGAACTACGAGACAAATATCTCGAGATATTTGTCTCGTAGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022816
VALIDATED
Acot10 MISSION shRNA Lentiviral Transduction Particles
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-194s1c1
Sequence:CCGGCCCTTACACATCCATCAAGTTCTCGAGAACTTGATGGATGTGTAAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-1138s1c1
Sequence:CCGGGCCTGTTGAAGTTGGTTCATTCTCGAGAATGAACCAACTTCAACAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-1328s1c1
Sequence:CCGGGAGTCCATGTTGTATTTAGATCTCGAGATCTAAATACAACATGGACTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-385s1c1
Sequence:CCGGCCCTGAACTACGAGACAAATACTCGAGTATTTGTCTCGTAGTTCAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-490s1c1
Sequence:CCGGCCACAATCATTCTACCAATATCTCGAGATATTGGTAGAATGATTGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022816.1-601s1c1
Sequence:CCGGCCATGTTAGCTGGGTTGGAAACTCGAGTTTCCAACCCAGCTAACATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000200479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022816.1-386s1c1
Sequence:CCGGCCTGAACTACGAGACAAATATCTCGAGATATTTGTCTCGTAGTTCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???