EMAIL THIS PAGE TO A FRIEND

Acot3

22 Gene Product Result for
Gene ID:
Rat(314304) acyl-CoA thioesterase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041181 MISSION® esiRNA targeting mouse Acot3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001108041 Rosetta Predictions rat pricing
NM_134246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234775 predicted 841
2 SASI_Rn02_00234776 predicted 1657
3 SASI_Rn02_00234777 predicted 1643
4 SASI_Rn02_00234778 predicted 903
5 SASI_Rn02_00234779 predicted 1656
6 SASI_Rn02_00234780 predicted 950
7 SASI_Rn02_00234781 predicted 827
8 SASI_Rn02_00234782 predicted 927
9 SASI_Rn02_00234783 predicted 908
10 SASI_Rn02_00234784 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183916 predicted 1848
2 SASI_Mm01_00183918 predicted 1561
3 SASI_Mm02_00339540 predicted 1659
4 SASI_Mm01_00183919 predicted 767
5 SASI_Mm01_00183920 predicted 1387
6 SASI_Mm01_00183921 predicted 1535
7 SASI_Mm01_00183922 predicted 1373
8 SASI_Mm01_00183923 predicted 1648
9 SASI_Mm01_00183924 predicted 1568
10 SASI_Mm01_00183925 predicted 1613
11 SASI_Mm01_00183917 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134246
Acot3 MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1554s1c1
Sequence:CCGGCAATGGCTCTATATCCAACATCTCGAGATGTTGGATATAGAGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134246.3-1628s21c1
Sequence:CCGGAGCGAGTCAAGAGAACCAAAGCTCGAGCTTTGGTTCTCTTGACTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1872s1c1
Sequence:CCGGCCATATTGAGCCTCCTTACTTCTCGAGAAGTAAGGAGGCTCAATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134246.3-1506s21c1
Sequence:CCGGTGCCATGGCCTCCTTCTTGAACTCGAGTTCAAGAAGGAGGCCATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134246.2-2307s1c1
Sequence:CCGGCCTGGAGTTCAAGGACTACTTCTCGAGAAGTAGTCCTTGAACTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1675s1c1
Sequence:CCGGCTTCTAAACAATCCTTTGGAACTCGAGTTCCAAAGGATTGTTTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1389s1c1
Sequence:CCGGCATGGACATTATCCACCTGGACTCGAGTCCAGGTGGATAATGTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.3-1617s1c1
Sequence:CCGGCATAAACACCAAGCGAGTCAACTCGAGTTGACTCGCTTGGTGTTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134246.3-2260s21c1
Sequence:CCGGAGCGAGCTGTAGTGCTGAAAGCTCGAGCTTTCAGCACTACAGCTCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134246
Acot3 MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1554s1c1
Sequence:CCGGCAATGGCTCTATATCCAACATCTCGAGATGTTGGATATAGAGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134246.3-1628s21c1
Sequence:CCGGAGCGAGTCAAGAGAACCAAAGCTCGAGCTTTGGTTCTCTTGACTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1872s1c1
Sequence:CCGGCCATATTGAGCCTCCTTACTTCTCGAGAAGTAAGGAGGCTCAATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134246.3-1506s21c1
Sequence:CCGGTGCCATGGCCTCCTTCTTGAACTCGAGTTCAAGAAGGAGGCCATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134246.2-2307s1c1
Sequence:CCGGCCTGGAGTTCAAGGACTACTTCTCGAGAAGTAGTCCTTGAACTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1675s1c1
Sequence:CCGGCTTCTAAACAATCCTTTGGAACTCGAGTTCCAAAGGATTGTTTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1389s1c1
Sequence:CCGGCATGGACATTATCCACCTGGACTCGAGTCCAGGTGGATAATGTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.3-1617s1c1
Sequence:CCGGCATAAACACCAAGCGAGTCAACTCGAGTTGACTCGCTTGGTGTTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134246.3-2260s21c1
Sequence:CCGGAGCGAGCTGTAGTGCTGAAAGCTCGAGCTTTCAGCACTACAGCTCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134246
Acot3 MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1554s1c1
Sequence:CCGGCAATGGCTCTATATCCAACATCTCGAGATGTTGGATATAGAGCCATTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000439115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134246.3-1628s21c1
Sequence:CCGGAGCGAGTCAAGAGAACCAAAGCTCGAGCTTTGGTTCTCTTGACTCGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000198397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1872s1c1
Sequence:CCGGCCATATTGAGCCTCCTTACTTCTCGAGAAGTAAGGAGGCTCAATATGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134246.3-1506s21c1
Sequence:CCGGTGCCATGGCCTCCTTCTTGAACTCGAGTTCAAGAAGGAGGCCATGGCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134246.2-2307s1c1
Sequence:CCGGCCTGGAGTTCAAGGACTACTTCTCGAGAAGTAGTCCTTGAACTCCAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000176724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1675s1c1
Sequence:CCGGCTTCTAAACAATCCTTTGGAACTCGAGTTCCAAAGGATTGTTTAGAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.2-1389s1c1
Sequence:CCGGCATGGACATTATCCACCTGGACTCGAGTCCAGGTGGATAATGTCCATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134246.3-1617s1c1
Sequence:CCGGCATAAACACCAAGCGAGTCAACTCGAGTTGACTCGCTTGGTGTTTATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134246.3-2260s21c1
Sequence:CCGGAGCGAGCTGTAGTGCTGAAAGCTCGAGCTTTCAGCACTACAGCTCGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???