EMAIL THIS PAGE TO A FRIEND

Acot5

21 Gene Product Result for
Gene ID:
Rat(503049) acyl-CoA thioesterase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU172441 MISSION® esiRNA targeting mouse Acot5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079709 Rosetta Predictions rat pricing
NM_145444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208089 predicted 995
2 SASI_Rn02_00208090 predicted 1071
3 SASI_Rn02_00208091 predicted 1074
4 SASI_Rn02_00208092 predicted 1111
5 SASI_Rn02_00208093 predicted 1259
6 SASI_Rn02_00208094 predicted 1207
7 SASI_Rn02_00208095 predicted 1204
8 SASI_Rn02_00208096 predicted 1188
9 SASI_Rn02_00208097 predicted 1125
10 SASI_Rn02_00208098 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127567 predicted 1012
2 SASI_Mm01_00127568 predicted 964
3 SASI_Mm01_00127569 predicted 696
4 SASI_Mm01_00127570 predicted 978
5 SASI_Mm01_00127571 predicted 746
6 SASI_Mm01_00127572 predicted 917
7 SASI_Mm01_00127573 predicted 988
8 SASI_Mm01_00127574 predicted 913
9 SASI_Mm01_00127575 predicted 878
10 SASI_Mm01_00127576 predicted 875
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145444
Acot5 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-912s1c1
Sequence:CCGGCCACGGTCAACGTTATTTCAACTCGAGTTGAAATAACGTTGACCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-980s1c1
Sequence:CCGGGAAAGGATCAAGGTGACCAAACTCGAGTTTGGTCACCTTGATCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-915s1c1
Sequence:CCGGCGGTCAACGTTATTTCAACATCTCGAGATGTTGAAATAACGTTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-730s1c1
Sequence:CCGGCCCTAAGGTTATAGACATCCTCTCGAGAGGATGTCTATAACCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-727s1c1
Sequence:CCGGCCTCCCTAAGGTTATAGACATCTCGAGATGTCTATAACCTTAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145444
Acot5 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-912s1c1
Sequence:CCGGCCACGGTCAACGTTATTTCAACTCGAGTTGAAATAACGTTGACCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-980s1c1
Sequence:CCGGGAAAGGATCAAGGTGACCAAACTCGAGTTTGGTCACCTTGATCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-915s1c1
Sequence:CCGGCGGTCAACGTTATTTCAACATCTCGAGATGTTGAAATAACGTTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-730s1c1
Sequence:CCGGCCCTAAGGTTATAGACATCCTCTCGAGAGGATGTCTATAACCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-727s1c1
Sequence:CCGGCCTCCCTAAGGTTATAGACATCTCGAGATGTCTATAACCTTAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145444
Acot5 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-912s1c1
Sequence:CCGGCCACGGTCAACGTTATTTCAACTCGAGTTGAAATAACGTTGACCGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-980s1c1
Sequence:CCGGGAAAGGATCAAGGTGACCAAACTCGAGTTTGGTCACCTTGATCCTTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-915s1c1
Sequence:CCGGCGGTCAACGTTATTTCAACATCTCGAGATGTTGAAATAACGTTGACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-730s1c1
Sequence:CCGGCCCTAAGGTTATAGACATCCTCTCGAGAGGATGTCTATAACCTTAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000113266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145444.2-727s1c1
Sequence:CCGGCCTCCCTAAGGTTATAGACATCTCGAGATGTCTATAACCTTAGGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???