EMAIL THIS PAGE TO A FRIEND

ACOT9

acyl-CoA thioesterase 9

59 Gene Product Result for
Synonyms: ACATE2 MT-ACT48 MTACT48
UniProtKB ID: Q9Y305, B3KNC9, B7ZM94
Gene ID:
Human(23597) Summary: The protein encoded by this gene is a mitochondrial acyl-CoA thioesterase of unknown function. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(56360) acyl-CoA thioesterase 9
Rat(302640) acyl-CoA thioesterase 9
chicken(418600) acyl-CoA thioesterase 9
dog(480864) acyl-CoA thioesterase 9
cow(527845) acyl-CoA thioesterase 9
domestic cat(101093336) acyl-CoA thioesterase 9
naked mole-rat(101725922) acyl-CoA thioesterase 9
domestic guinea pig(100715299) acyl-CoA thioesterase 9
sheep(101113041) acyl-CoA thioesterase 9
Domestic Rabbit(100343088) acyl-CoA thioesterase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033583 Rosetta Predictions human pricing
NM_001037171 Rosetta Predictions human pricing
NM_001013960 Rosetta Predictions rat pricing
NM_019736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010011 predicted 558
2 SASI_Hs01_00010012 predicted 1296
3 SASI_Hs01_00010013 predicted 1179
4 SASI_Hs01_00010014 predicted 650
5 SASI_Hs01_00010016 predicted 1446
6 SASI_Hs01_00010017 predicted 1367
7 SASI_Hs01_00010018 predicted 691
8 SASI_Hs01_00010019 predicted 1223
9 SASI_Hs01_00010020 predicted 621
10 SASI_Hs02_00308071 predicted 950
11 SASI_Hs01_00010015 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200797 predicted 586
2 SASI_Hs01_00200798 predicted 1320
3 SASI_Hs01_00200799 predicted 1213
4 SASI_Hs01_00200800 predicted 678
5 SASI_Hs01_00200802 predicted 1473
6 SASI_Hs01_00200803 predicted 1395
7 SASI_Hs01_00200804 predicted 709
8 SASI_Hs01_00200805 predicted 1244
9 SASI_Hs01_00200806 predicted 651
10 SASI_Hs02_00308232 predicted 972
11 SASI_Hs01_00200801 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201284 predicted 1124
2 SASI_Rn01_00050834 predicted 219
3 SASI_Rn02_00201285 predicted 418
4 SASI_Rn01_00050835 predicted 1097
5 SASI_Rn01_00050837 predicted 436
6 SASI_Rn01_00050838 predicted 1117
7 SASI_Rn01_00050839 predicted 958
8 SASI_Rn01_00050840 predicted 1303
9 SASI_Rn01_00050841 predicted 564
10 SASI_Rn01_00050842 predicted 1219
11 SASI_Rn01_00050833 predicted 375
12 SASI_Rn01_00050836 predicted 899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048017 predicted 283
2 SASI_Mm01_00048018 predicted 550
3 SASI_Mm01_00048019 predicted 1252
4 SASI_Mm01_00048020 predicted 286
5 SASI_Mm01_00048021 predicted 1271
6 SASI_Mm01_00048022 predicted 1541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019736
VALIDATED
ACOT9 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-1246s21c1
Sequence:CCGGCCCAGGACAATTACATCCAAGCTCGAGCTTGGATGTAATTGTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-1270s21c1
Sequence:CCGGGAGTCCATAGTGAAGTGTCTTCTCGAGAAGACACTTCACTATGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-283s21c1
Sequence:CCGGTGCGGGAGATAGTAGGCGTATCTCGAGATACGCCTACTATCTCCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-828s21c1
Sequence:CCGGGAGGAAGAAGAGCTCTTTAAACTCGAGTTTAAAGAGCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-711s21c1
Sequence:CCGGCAGCTGCACAATGATGAGAAACTCGAGTTTCTCATCATTGTGCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019736
VALIDATED
ACOT9 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-1246s21c1
Sequence:CCGGCCCAGGACAATTACATCCAAGCTCGAGCTTGGATGTAATTGTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-1270s21c1
Sequence:CCGGGAGTCCATAGTGAAGTGTCTTCTCGAGAAGACACTTCACTATGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-283s21c1
Sequence:CCGGTGCGGGAGATAGTAGGCGTATCTCGAGATACGCCTACTATCTCCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-828s21c1
Sequence:CCGGGAGGAAGAAGAGCTCTTTAAACTCGAGTTTAAAGAGCTCTTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-711s21c1
Sequence:CCGGCAGCTGCACAATGATGAGAAACTCGAGTTTCTCATCATTGTGCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019736
VALIDATED
ACOT9 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-1246s21c1
Sequence:CCGGCCCAGGACAATTACATCCAAGCTCGAGCTTGGATGTAATTGTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-1270s21c1
Sequence:CCGGGAGTCCATAGTGAAGTGTCTTCTCGAGAAGACACTTCACTATGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-283s21c1
Sequence:CCGGTGCGGGAGATAGTAGGCGTATCTCGAGATACGCCTACTATCTCCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-828s21c1
Sequence:CCGGGAGGAAGAAGAGCTCTTTAAACTCGAGTTTAAAGAGCTCTTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019736.3-711s21c1
Sequence:CCGGCAGCTGCACAATGATGAGAAACTCGAGTTTCTCATCATTGTGCAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012332
VALIDATED
ACOT9 MISSION shRNA Bacterial Glycerol Stock
acyl-CoA thioesterase 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-489s1c1
Sequence:CCGGCCTGGTGGATAAGATTGATATCTCGAGATATCAATCTTATCCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-606s1c1
Sequence:CCGGCCAGTTACATGGTGATGAATTCTCGAGAATTCATCACCATGTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-973s1c1
Sequence:CCGGCGGATCTTTGGTGGTTTCCTTCTCGAGAAGGAAACCACCAAAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-1200s1c1
Sequence:CCGGGCATACAACCACCAATGTCTTCTCGAGAAGACATTGGTGGTTGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-339s1c1
Sequence:CCGGGCCTGAATTACGAGAGAAATACTCGAGTATTTCTCTCGTAATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012332
VALIDATED
ACOT9 MISSION shRNA shRNA Plasmid DNA
acyl-CoA thioesterase 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-489s1c1
Sequence:CCGGCCTGGTGGATAAGATTGATATCTCGAGATATCAATCTTATCCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-606s1c1
Sequence:CCGGCCAGTTACATGGTGATGAATTCTCGAGAATTCATCACCATGTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-973s1c1
Sequence:CCGGCGGATCTTTGGTGGTTTCCTTCTCGAGAAGGAAACCACCAAAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-1200s1c1
Sequence:CCGGGCATACAACCACCAATGTCTTCTCGAGAAGACATTGGTGGTTGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-339s1c1
Sequence:CCGGGCCTGAATTACGAGAGAAATACTCGAGTATTTCTCTCGTAATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012332
VALIDATED
ACOT9 MISSION shRNA Lentiviral Transduction Particles
acyl-CoA thioesterase 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-489s1c1
Sequence:CCGGCCTGGTGGATAAGATTGATATCTCGAGATATCAATCTTATCCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-606s1c1
Sequence:CCGGCCAGTTACATGGTGATGAATTCTCGAGAATTCATCACCATGTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-973s1c1
Sequence:CCGGCGGATCTTTGGTGGTTTCCTTCTCGAGAAGGAAACCACCAAAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-1200s1c1
Sequence:CCGGGCATACAACCACCAATGTCTTCTCGAGAAGACATTGGTGGTTGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012332.1-339s1c1
Sequence:CCGGGCCTGAATTACGAGAGAAATACTCGAGTATTTCTCTCGTAATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)