EMAIL THIS PAGE TO A FRIEND

ACRBP

acrosin binding protein

86 Gene Product Result for
Synonyms: CT23 OY-TES-1 SP32
UniProtKB ID: Q8NEB7, Q9BY87
Gene ID:
Human(84519) Summary: The protein encoded by this gene is similar to proacrosin binding protein sp32 precursor found in mouse, guinea pig, and pig. This protein is located in the sperm acrosome and is thought to function as a binding protein to proacrosin for packaging and condensation of the acrosin zymogen in the acrosomal matrix. This protein is a member of the cancer/testis family of antigens and it is found to be immunogenic. In normal tissues, this mRNA is expressed only in testis, whereas it is detected in a range of different tumor types such as bladder, breast, lung, liver, and colon. [provided by RefSeq, Jul 2008]
Mouse(54137) proacrosin binding protein
Rat(500316) acrosin binding protein
domestic guinea pig(100135468) proacrosin binding protein
naked mole-rat(101709152) acrosin binding protein
sheep(101112553) acrosin binding protein
Domestic Rabbit(100338899) acrosin binding protein
chicken(418280) acrosin binding protein
domestic cat(101082322) acrosin binding protein
cow(515434) acrosin binding protein
Horse(100052268) acrosin binding protein
dog(477713) acrosin binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016845 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016845 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016845 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032489 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122401 MISSION® esiRNA esiRNA human ACRBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032489 Rosetta Predictions human pricing
NM_001025049 Rosetta Predictions rat pricing
NM_001127340 Rosetta Predictions mouse pricing
NM_016845 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089379 predicted 1038
2 SASI_Hs01_00089380 predicted 344
3 SASI_Hs01_00089381 predicted 1154
4 SASI_Hs01_00089382 predicted 404
5 SASI_Hs01_00089383 predicted 451
6 SASI_Hs01_00089384 predicted 1496
7 SASI_Hs01_00089385 predicted 1241
8 SASI_Hs01_00089387 predicted 1611
9 SASI_Hs01_00089388 predicted 1387
10 SASI_Hs02_00359949 predicted 431
11 SASI_Hs01_00089386 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025049 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041247 predicted 201
2 SASI_Rn01_00041249 predicted 1036
3 SASI_Rn01_00041251 predicted 296
4 SASI_Rn01_00041252 predicted 385
5 SASI_Rn01_00041253 predicted 344
6 SASI_Rn01_00041254 predicted 332
7 SASI_Rn01_00041255 predicted 389
8 SASI_Rn02_00202979 predicted 219
9 SASI_Rn02_00202980 predicted 192
10 SASI_Rn02_00202981 predicted 363
11 SASI_Rn01_00041248 predicted 376
12 SASI_Rn01_00041250 predicted 338
13 SASI_Rn01_00041256 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310257 predicted 288
2 SASI_Mm02_00310258 predicted 291
3 SASI_Mm02_00310259 predicted 286
4 SASI_Mm02_00310260 predicted 294
5 SASI_Mm02_00310261 predicted 381
6 SASI_Mm02_00310262 predicted 329
7 SASI_Mm02_00310263 predicted 404
8 SASI_Mm02_00310264 predicted 358
9 SASI_Mm02_00310265 predicted 388
10 SASI_Mm02_00310266 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016845 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063261 predicted 288
2 SASI_Mm02_00323616 predicted 292
3 SASI_Mm02_00323617 predicted 293
4 SASI_Mm02_00323618 predicted 296
5 SASI_Mm02_00323619 predicted 381
6 SASI_Mm02_00323620 predicted 331
7 SASI_Mm02_00323621 predicted 399
8 SASI_Mm02_00323622 predicted 357
9 SASI_Mm02_00323623 predicted 386
10 SASI_Mm02_00323624 predicted 391
11 SASI_Mm01_00063255 predicted 1188
12 SASI_Mm01_00063256 predicted 1225
13 SASI_Mm01_00063257 predicted 1563
14 SASI_Mm01_00063258 predicted 1386
15 SASI_Mm01_00063259 predicted 1449
16 SASI_Mm01_00063260 predicted 1623
17 SASI_Mm01_00063262 predicted 1481
18 SASI_Mm01_00063263 predicted 1002
19 SASI_Mm01_00063264 predicted 1329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016845
ACRBP MISSION shRNA Bacterial Glycerol Stock
acrosin binding protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016845.1-1681s1c1
Sequence:CCGGCCCAGCTCTACCTTGCTCCATCTCGAGATGGAGCAAGGTAGAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-1444s1c1
Sequence:CCGGCCACCAAGATTTGTGACACAACTCGAGTTGTGTCACAAATCTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-343s1c1
Sequence:CCGGGCCAGTTTGCTCAGTATCGTTCTCGAGAACGATACTGAGCAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-1289s1c1
Sequence:CCGGGATCCCAGATAAAGGACGATTCTCGAGAATCGTCCTTTATCTGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016845
ACRBP MISSION shRNA shRNA Plasmid DNA
acrosin binding protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016845.1-1681s1c1
Sequence:CCGGCCCAGCTCTACCTTGCTCCATCTCGAGATGGAGCAAGGTAGAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-1444s1c1
Sequence:CCGGCCACCAAGATTTGTGACACAACTCGAGTTGTGTCACAAATCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-343s1c1
Sequence:CCGGGCCAGTTTGCTCAGTATCGTTCTCGAGAACGATACTGAGCAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-1289s1c1
Sequence:CCGGGATCCCAGATAAAGGACGATTCTCGAGAATCGTCCTTTATCTGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016845
ACRBP MISSION shRNA Lentiviral Transduction Particles
acrosin binding protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120637    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016845.1-1681s1c1
Sequence:CCGGCCCAGCTCTACCTTGCTCCATCTCGAGATGGAGCAAGGTAGAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-1444s1c1
Sequence:CCGGCCACCAAGATTTGTGACACAACTCGAGTTGTGTCACAAATCTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-343s1c1
Sequence:CCGGGCCAGTTTGCTCAGTATCGTTCTCGAGAACGATACTGAGCAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016845.1-1289s1c1
Sequence:CCGGGATCCCAGATAAAGGACGATTCTCGAGAATCGTCCTTTATCTGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032489
ACRBP MISSION shRNA Bacterial Glycerol Stock
acrosin binding protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-442s1c1
Sequence:CCGGCCTAACACTCTCAAGGAGATACTCGAGTATCTCCTTGAGAGTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-912s1c1
Sequence:CCGGCATTCGATCAGCCCAGGAAATCTCGAGATTTCCTGGGCTGATCGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-155s1c1
Sequence:CCGGGCCCTCTCTCTCCTACCGAATCTCGAGATTCGGTAGGAGAGAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-1497s1c1
Sequence:CCGGGTACCCAAACTACTGTTCCTTCTCGAGAAGGAACAGTAGTTTGGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032489.2-1715s1c1
Sequence:CCGGCTGCCCACGTTCTCTATTGTTCTCGAGAACAATAGAGAACGTGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032489.2-573s21c1
Sequence:CCGGCGTGGAAGAGCTCCTACAATCCTCGAGGATTGTAGGAGCTCTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032489.2-1474s21c1
Sequence:CCGGATTTGTGACACAGACTATATCCTCGAGGATATAGTCTGTGTCACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032489
ACRBP MISSION shRNA shRNA Plasmid DNA
acrosin binding protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-442s1c1
Sequence:CCGGCCTAACACTCTCAAGGAGATACTCGAGTATCTCCTTGAGAGTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-912s1c1
Sequence:CCGGCATTCGATCAGCCCAGGAAATCTCGAGATTTCCTGGGCTGATCGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-155s1c1
Sequence:CCGGGCCCTCTCTCTCCTACCGAATCTCGAGATTCGGTAGGAGAGAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-1497s1c1
Sequence:CCGGGTACCCAAACTACTGTTCCTTCTCGAGAAGGAACAGTAGTTTGGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032489.2-1715s1c1
Sequence:CCGGCTGCCCACGTTCTCTATTGTTCTCGAGAACAATAGAGAACGTGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032489.2-573s21c1
Sequence:CCGGCGTGGAAGAGCTCCTACAATCCTCGAGGATTGTAGGAGCTCTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032489.2-1474s21c1
Sequence:CCGGATTTGTGACACAGACTATATCCTCGAGGATATAGTCTGTGTCACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032489
ACRBP MISSION shRNA Lentiviral Transduction Particles
acrosin binding protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-442s1c1
Sequence:CCGGCCTAACACTCTCAAGGAGATACTCGAGTATCTCCTTGAGAGTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-912s1c1
Sequence:CCGGCATTCGATCAGCCCAGGAAATCTCGAGATTTCCTGGGCTGATCGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-155s1c1
Sequence:CCGGGCCCTCTCTCTCCTACCGAATCTCGAGATTCGGTAGGAGAGAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032489.2-1497s1c1
Sequence:CCGGGTACCCAAACTACTGTTCCTTCTCGAGAAGGAACAGTAGTTTGGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032489.2-1715s1c1
Sequence:CCGGCTGCCCACGTTCTCTATTGTTCTCGAGAACAATAGAGAACGTGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032489.2-573s21c1
Sequence:CCGGCGTGGAAGAGCTCCTACAATCCTCGAGGATTGTAGGAGCTCTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032489.2-1474s21c1
Sequence:CCGGATTTGTGACACAGACTATATCCTCGAGGATATAGTCTGTGTCACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)