EMAIL THIS PAGE TO A FRIEND

ACVR2B

activin A receptor, type IIB

307 Gene Product Result for
Synonyms: ACTRIIB ActR-IIB HTX4
UniProtKB ID: Q13705, Q4VAV0
Gene ID:
Human(93) Summary: Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]
Mouse(11481) activin receptor IIB
Rat(25366) activin A receptor, type IIB
Zebrafish(30457) activin receptor IIb
dog(485590) activin A receptor, type IIB
cow(282131) activin A receptor, type IIB
Horse(100053588) activin A receptor, type IIB
domestic cat(101086087) activin A receptor, type IIB
chicken(374213) activin A receptor, type IIB
naked mole-rat(101711703) activin A receptor, type IIB
domestic guinea pig(100722791) activin A receptor, type IIB
sheep(443156) activin A receptor, type IIB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001106 Rosetta Predictions human pricing
NM_031554 Rosetta Predictions rat pricing
NM_007397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090995 predicted 778
2 SASI_Hs01_00090996 predicted 647
3 SASI_Hs01_00090997 predicted 653
4 SASI_Hs01_00090998 predicted 519
5 SASI_Hs01_00090999 predicted 1325
6 SASI_Hs01_00091000 predicted 1104
7 SASI_Hs01_00091001 predicted 866
8 SASI_Hs01_00091003 predicted 663
9 SASI_Hs01_00091004 predicted 1154
10 SASI_Hs02_00324668 predicted 1169
11 SASI_Hs01_00091002 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120615 predicted 1410
2 SASI_Rn01_00120616 predicted 1154
3 SASI_Rn01_00120617 predicted 1104
4 SASI_Rn02_00264746 predicted 803
5 SASI_Rn01_00120618 predicted 1532
6 SASI_Rn01_00120619 predicted 1344
7 SASI_Rn01_00120620 predicted 853
8 SASI_Rn01_00120621 predicted 1324
9 SASI_Rn01_00120622 predicted 451
10 SASI_Rn01_00120624 predicted 628
11 SASI_Rn01_00120623 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187572 predicted 1052
2 SASI_Mm01_00187573 predicted 613
3 SASI_Mm01_00187574 predicted 1078
4 SASI_Mm02_00311507 predicted 508
5 SASI_Mm01_00187575 predicted 271
6 SASI_Mm01_00187576 predicted 844
7 SASI_Mm01_00187577 predicted 1240
8 SASI_Mm01_00187578 predicted 1225
9 SASI_Mm01_00187579 predicted 547
10 SASI_Mm01_00187580 predicted 758
11 SASI_Mm01_00187581 predicted 279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001106
VALIDATED
ACVR2B MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IIB
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-1021s1c1
Sequence:CCGGCTTTGGCTTGGCTGTTCGATTCTCGAGAATCGAACAGCCAAGCCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-1312s1c1
Sequence:CCGGGAGGCCCACCATTAAAGATCACTCGAGTGATCTTTAATGGTGGGCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-232s1c1
Sequence:CCGGCTGCTGGCTAGATGACTTCAACTCGAGTTGAAGTCATCTAGCCAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-1139s1c1
Sequence:CCGGGATGCCTTCCTGCGCATTGACCTCGAGGTCAATGCGCAGGAAGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-172s1c1
Sequence:CCGGGCTGCACTGCTACGCCTCCTGCTCGAGCAGGAGGCGTAGCAGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001106.2-79s1c1
Sequence:CCGGGACACGGGAGTGCATCTACTACTCGAGTAGTAGATGCACTCCCGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-624s1c1
Sequence:CCGGCCCAGCTCATGAATGACTTTGCTCGAGCAAAGTCATTCATGAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-844s1c1
Sequence:CCGGCATCATCACATGGAACGAACTCTCGAGAGTTCGTTCCATGTGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-1159s21c1
Sequence:CCGGGATGCCTTCCTGCGCATTGACCTCGAGGTCAATGCGCAGGAAGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-1041s21c1
Sequence:CCGGCTTTGGCTTGGCTGTTCGATTCTCGAGAATCGAACAGCCAAGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-864s21c1
Sequence:CCGGCATCATCACATGGAACGAACTCTCGAGAGTTCGTTCCATGTGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-252s21c1
Sequence:CCGGCTGCTGGCTAGATGACTTCAACTCGAGTTGAAGTCATCTAGCCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-99s21c1
Sequence:CCGGGACACGGGAGTGCATCTACTACTCGAGTAGTAGATGCACTCCCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001106
VALIDATED
ACVR2B MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IIB
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-1021s1c1
Sequence:CCGGCTTTGGCTTGGCTGTTCGATTCTCGAGAATCGAACAGCCAAGCCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-1312s1c1
Sequence:CCGGGAGGCCCACCATTAAAGATCACTCGAGTGATCTTTAATGGTGGGCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-232s1c1
Sequence:CCGGCTGCTGGCTAGATGACTTCAACTCGAGTTGAAGTCATCTAGCCAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-1139s1c1
Sequence:CCGGGATGCCTTCCTGCGCATTGACCTCGAGGTCAATGCGCAGGAAGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-172s1c1
Sequence:CCGGGCTGCACTGCTACGCCTCCTGCTCGAGCAGGAGGCGTAGCAGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001106.2-79s1c1
Sequence:CCGGGACACGGGAGTGCATCTACTACTCGAGTAGTAGATGCACTCCCGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-624s1c1
Sequence:CCGGCCCAGCTCATGAATGACTTTGCTCGAGCAAAGTCATTCATGAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-844s1c1
Sequence:CCGGCATCATCACATGGAACGAACTCTCGAGAGTTCGTTCCATGTGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-1159s21c1
Sequence:CCGGGATGCCTTCCTGCGCATTGACCTCGAGGTCAATGCGCAGGAAGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-1041s21c1
Sequence:CCGGCTTTGGCTTGGCTGTTCGATTCTCGAGAATCGAACAGCCAAGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-864s21c1
Sequence:CCGGCATCATCACATGGAACGAACTCTCGAGAGTTCGTTCCATGTGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-252s21c1
Sequence:CCGGCTGCTGGCTAGATGACTTCAACTCGAGTTGAAGTCATCTAGCCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-99s21c1
Sequence:CCGGGACACGGGAGTGCATCTACTACTCGAGTAGTAGATGCACTCCCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001106
VALIDATED
ACVR2B MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IIB
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-1021s1c1
Sequence:CCGGCTTTGGCTTGGCTGTTCGATTCTCGAGAATCGAACAGCCAAGCCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-1312s1c1
Sequence:CCGGGAGGCCCACCATTAAAGATCACTCGAGTGATCTTTAATGGTGGGCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.x-232s1c1
Sequence:CCGGCTGCTGGCTAGATGACTTCAACTCGAGTTGAAGTCATCTAGCCAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-1139s1c1
Sequence:CCGGGATGCCTTCCTGCGCATTGACCTCGAGGTCAATGCGCAGGAAGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-172s1c1
Sequence:CCGGGCTGCACTGCTACGCCTCCTGCTCGAGCAGGAGGCGTAGCAGTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001106.2-79s1c1
Sequence:CCGGGACACGGGAGTGCATCTACTACTCGAGTAGTAGATGCACTCCCGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-624s1c1
Sequence:CCGGCCCAGCTCATGAATGACTTTGCTCGAGCAAAGTCATTCATGAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001106.2-844s1c1
Sequence:CCGGCATCATCACATGGAACGAACTCTCGAGAGTTCGTTCCATGTGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-1159s21c1
Sequence:CCGGGATGCCTTCCTGCGCATTGACCTCGAGGTCAATGCGCAGGAAGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-1041s21c1
Sequence:CCGGCTTTGGCTTGGCTGTTCGATTCTCGAGAATCGAACAGCCAAGCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-864s21c1
Sequence:CCGGCATCATCACATGGAACGAACTCTCGAGAGTTCGTTCCATGTGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-252s21c1
Sequence:CCGGCTGCTGGCTAGATGACTTCAACTCGAGTTGAAGTCATCTAGCCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001106.3-99s21c1
Sequence:CCGGGACACGGGAGTGCATCTACTACTCGAGTAGTAGATGCACTCCCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007397
ACVR2B MISSION shRNA Bacterial Glycerol Stock
activin A receptor, type IIB
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007397.1-1336s1c1
Sequence:CCGGCGATGAGTACATGCTGCCCTTCTCGAGAAGGGCAGCATGTACTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007397.1-758s1c1
Sequence:CCGGGCTGTGAAGATCTTCCCACTTCTCGAGAAGTGGGAAGATCTTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-795s21c1
Sequence:CCGGGTGGCAGAGTGAACGGGAAATCTCGAGATTTCCCGTTCACTCTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-1419s21c1
Sequence:CCGGGAAGATGAGGCCCACGATTAACTCGAGTTAATCGTGGGCCTCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-997s21c1
Sequence:CCGGATGTCACGAGGCCTCTCATACCTCGAGGTATGAGAGGCCTCGTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-1048s21c1
Sequence:CCGGGAGGGCCACAAGCCTTCTATTCTCGAGAATAGAAGGCTTGTGGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007397
ACVR2B MISSION shRNA shRNA Plasmid DNA
activin A receptor, type IIB
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007397.1-1336s1c1
Sequence:CCGGCGATGAGTACATGCTGCCCTTCTCGAGAAGGGCAGCATGTACTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007397.1-758s1c1
Sequence:CCGGGCTGTGAAGATCTTCCCACTTCTCGAGAAGTGGGAAGATCTTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-795s21c1
Sequence:CCGGGTGGCAGAGTGAACGGGAAATCTCGAGATTTCCCGTTCACTCTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-1419s21c1
Sequence:CCGGGAAGATGAGGCCCACGATTAACTCGAGTTAATCGTGGGCCTCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-997s21c1
Sequence:CCGGATGTCACGAGGCCTCTCATACCTCGAGGTATGAGAGGCCTCGTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-1048s21c1
Sequence:CCGGGAGGGCCACAAGCCTTCTATTCTCGAGAATAGAAGGCTTGTGGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007397
ACVR2B MISSION shRNA Lentiviral Transduction Particles
activin A receptor, type IIB
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007397.1-1336s1c1
Sequence:CCGGCGATGAGTACATGCTGCCCTTCTCGAGAAGGGCAGCATGTACTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007397.1-758s1c1
Sequence:CCGGGCTGTGAAGATCTTCCCACTTCTCGAGAAGTGGGAAGATCTTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-795s21c1
Sequence:CCGGGTGGCAGAGTGAACGGGAAATCTCGAGATTTCCCGTTCACTCTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-1419s21c1
Sequence:CCGGGAAGATGAGGCCCACGATTAACTCGAGTTAATCGTGGGCCTCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-997s21c1
Sequence:CCGGATGTCACGAGGCCTCTCATACCTCGAGGTATGAGAGGCCTCGTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007397.2-1048s21c1
Sequence:CCGGGAGGGCCACAAGCCTTCTATTCTCGAGAATAGAAGGCTTGTGGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)