EMAIL THIS PAGE TO A FRIEND

ACYP2

acylphosphatase 2, muscle type

51 Gene Product Result for
Synonyms: ACYM ACYP
UniProtKB ID: P14621
Gene ID:
Human(98) Summary: Acylphosphatase can hydrolyze the phosphoenzyme intermediate of different membrane pumps, particularly the Ca2+/Mg2+-ATPase from sarcoplasmic reticulum of skeletal muscle. Two isoenzymes have been isolated, called muscle acylphosphatase and erythrocyte acylphosphatase on the basis of their tissue localization. This gene encodes the muscle-type isoform (MT). An increase of the MT isoform is associated with muscle differentiation. [provided by RefSeq, Jul 2008]
Mouse(75572) acylphosphatase 2, muscle type
Rat(364224) acylphosphatase 2, muscle type
domestic guinea pig(100715746) acylphosphatase 2, muscle type
fruit fly(41910) Acylphosphatase 2
cow(767889) acylphosphatase 2, muscle type
dog(474595) acylphosphatase 2, muscle type
chicken(421217) acylphosphatase 2, muscle type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138448 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138448 Rosetta Predictions human pricing
XM_001055227 Rosetta Predictions rat pricing
NM_029344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107883 predicted 712
2 SASI_Hs01_00107884 predicted 742
3 SASI_Hs01_00107885 predicted 642
4 SASI_Hs01_00107886 predicted 640
5 SASI_Hs01_00107887 predicted 646
6 SASI_Hs01_00107888 predicted 762
7 SASI_Hs01_00107890 predicted 472
8 SASI_Hs01_00107891 predicted 438
9 SASI_Hs01_00107892 predicted 489
10 SASI_Hs02_00363619 predicted 523
11 SASI_Hs01_00107889 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278876 predicted 221
2 SASI_Rn02_00278877 predicted 233
3 SASI_Rn02_00278878 predicted 355
4 SASI_Rn02_00278879 predicted 267
5 SASI_Rn02_00278880 predicted 354
6 SASI_Rn02_00278881 predicted 218
7 SASI_Rn02_00278882 predicted 232
8 SASI_Rn02_00278883 predicted 253
9 SASI_Rn02_00278884 predicted 185
10 SASI_Rn02_00278885 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139267 predicted 245
2 SASI_Mm01_00139268 predicted 349
3 SASI_Mm01_00139269 predicted 216
4 SASI_Mm02_00335182 predicted 349
5 SASI_Mm01_00139270 predicted 237
6 SASI_Mm01_00139271 predicted 345
7 SASI_Mm01_00139272 predicted 351
8 SASI_Mm01_00139274 predicted 251
9 SASI_Mm01_00139275 predicted 226
10 SASI_Mm01_00139276 predicted 293
11 SASI_Mm01_00139273 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029344
VALIDATED
ACYP2 MISSION shRNA Bacterial Glycerol Stock
acylphosphatase 2, muscle type
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-129s21c1
Sequence:CCGGGCTAAGAAACGAGGTCTGGTTCTCGAGAACCAGACCTCGTTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029344.3-358s21c1
Sequence:CCGGGCACTGCTTATGTTATAGAAACTCGAGTTTCTATAACATAAGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-92s21c1
Sequence:CCGGGCAAGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-53s21c1
Sequence:CCGGGCTGCTCAAGTCTGTGGACTACTCGAGTAGTCCACAGACTTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-152s21c1
Sequence:CCGGCTGGGTGAAGAACACAAGCAACTCGAGTTGCTTGTGTTCTTCACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-129s1c1
Sequence:CCGGGCTAAGAAACGAGGTCTGGTTCTCGAGAACCAGACCTCGTTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-92s1c1
Sequence:CCGGGCAAGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029344.1-358s1c1
Sequence:CCGGGCACTGCTTATGTTATAGAAACTCGAGTTTCTATAACATAAGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029344.1-53s1c1
Sequence:CCGGGCTGCTCAAGTCTGTGGACTACTCGAGTAGTCCACAGACTTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-152s1c1
Sequence:CCGGCTGGGTGAAGAACACAAGCAACTCGAGTTGCTTGTGTTCTTCACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029344
VALIDATED
ACYP2 MISSION shRNA shRNA Plasmid DNA
acylphosphatase 2, muscle type
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-129s21c1
Sequence:CCGGGCTAAGAAACGAGGTCTGGTTCTCGAGAACCAGACCTCGTTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029344.3-358s21c1
Sequence:CCGGGCACTGCTTATGTTATAGAAACTCGAGTTTCTATAACATAAGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-92s21c1
Sequence:CCGGGCAAGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-53s21c1
Sequence:CCGGGCTGCTCAAGTCTGTGGACTACTCGAGTAGTCCACAGACTTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-152s21c1
Sequence:CCGGCTGGGTGAAGAACACAAGCAACTCGAGTTGCTTGTGTTCTTCACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-129s1c1
Sequence:CCGGGCTAAGAAACGAGGTCTGGTTCTCGAGAACCAGACCTCGTTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-92s1c1
Sequence:CCGGGCAAGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029344.1-358s1c1
Sequence:CCGGGCACTGCTTATGTTATAGAAACTCGAGTTTCTATAACATAAGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029344.1-53s1c1
Sequence:CCGGGCTGCTCAAGTCTGTGGACTACTCGAGTAGTCCACAGACTTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-152s1c1
Sequence:CCGGCTGGGTGAAGAACACAAGCAACTCGAGTTGCTTGTGTTCTTCACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029344
VALIDATED
ACYP2 MISSION shRNA Lentiviral Transduction Particles
acylphosphatase 2, muscle type
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-129s21c1
Sequence:CCGGGCTAAGAAACGAGGTCTGGTTCTCGAGAACCAGACCTCGTTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029344.3-358s21c1
Sequence:CCGGGCACTGCTTATGTTATAGAAACTCGAGTTTCTATAACATAAGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-92s21c1
Sequence:CCGGGCAAGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-53s21c1
Sequence:CCGGGCTGCTCAAGTCTGTGGACTACTCGAGTAGTCCACAGACTTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029344.3-152s21c1
Sequence:CCGGCTGGGTGAAGAACACAAGCAACTCGAGTTGCTTGTGTTCTTCACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-129s1c1
Sequence:CCGGGCTAAGAAACGAGGTCTGGTTCTCGAGAACCAGACCTCGTTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-92s1c1
Sequence:CCGGGCAAGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029344.1-358s1c1
Sequence:CCGGGCACTGCTTATGTTATAGAAACTCGAGTTTCTATAACATAAGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029344.1-53s1c1
Sequence:CCGGGCTGCTCAAGTCTGTGGACTACTCGAGTAGTCCACAGACTTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029344.1-152s1c1
Sequence:CCGGCTGGGTGAAGAACACAAGCAACTCGAGTTGCTTGTGTTCTTCACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138448
VALIDATED
ACYP2 MISSION shRNA Bacterial Glycerol Stock
acylphosphatase 2, muscle type
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-649s21c1
Sequence:CCGGCGCATTGACCGCACAAACTTTCTCGAGAAAGTTTGTGCGGTCAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138448.3-541s21c1
Sequence:CCGGTGGGTGAAGAATACCAGCAAACTCGAGTTTGCTGGTATTCTTCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-626s21c1
Sequence:CCGGGCAAGGTTGGAAGCCCTAGTTCTCGAGAACTAGGGCTTCCAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-480s21c1
Sequence:CCGGGCAGGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-626s1c1
Sequence:CCGGGCAAGGTTGGAAGCCCTAGTTCTCGAGAACTAGGGCTTCCAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-490s1c1
Sequence:CCGGTGCTTCAGAATGTATACAGAACTCGAGTTCTGTATACATTCTGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-541s1c1
Sequence:CCGGTGGGTGAAGAATACCAGCAAACTCGAGTTTGCTGGTATTCTTCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-480s1c1
Sequence:CCGGGCAGGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-649s1c1
Sequence:CCGGCGCATTGACCGCACAAACTTTCTCGAGAAAGTTTGTGCGGTCAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138448
VALIDATED
ACYP2 MISSION shRNA shRNA Plasmid DNA
acylphosphatase 2, muscle type
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-649s21c1
Sequence:CCGGCGCATTGACCGCACAAACTTTCTCGAGAAAGTTTGTGCGGTCAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138448.3-541s21c1
Sequence:CCGGTGGGTGAAGAATACCAGCAAACTCGAGTTTGCTGGTATTCTTCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-626s21c1
Sequence:CCGGGCAAGGTTGGAAGCCCTAGTTCTCGAGAACTAGGGCTTCCAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-480s21c1
Sequence:CCGGGCAGGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-626s1c1
Sequence:CCGGGCAAGGTTGGAAGCCCTAGTTCTCGAGAACTAGGGCTTCCAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-490s1c1
Sequence:CCGGTGCTTCAGAATGTATACAGAACTCGAGTTCTGTATACATTCTGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-541s1c1
Sequence:CCGGTGGGTGAAGAATACCAGCAAACTCGAGTTTGCTGGTATTCTTCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-480s1c1
Sequence:CCGGGCAGGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-649s1c1
Sequence:CCGGCGCATTGACCGCACAAACTTTCTCGAGAAAGTTTGTGCGGTCAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138448
VALIDATED
ACYP2 MISSION shRNA Lentiviral Transduction Particles
acylphosphatase 2, muscle type
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-649s21c1
Sequence:CCGGCGCATTGACCGCACAAACTTTCTCGAGAAAGTTTGTGCGGTCAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_138448.3-541s21c1
Sequence:CCGGTGGGTGAAGAATACCAGCAAACTCGAGTTTGCTGGTATTCTTCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-626s21c1
Sequence:CCGGGCAAGGTTGGAAGCCCTAGTTCTCGAGAACTAGGGCTTCCAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138448.3-480s21c1
Sequence:CCGGGCAGGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-626s1c1
Sequence:CCGGGCAAGGTTGGAAGCCCTAGTTCTCGAGAACTAGGGCTTCCAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-490s1c1
Sequence:CCGGTGCTTCAGAATGTATACAGAACTCGAGTTCTGTATACATTCTGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-541s1c1
Sequence:CCGGTGGGTGAAGAATACCAGCAAACTCGAGTTTGCTGGTATTCTTCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-480s1c1
Sequence:CCGGGCAGGGTGTTTGCTTCAGAATCTCGAGATTCTGAAGCAAACACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_138448.2-649s1c1
Sequence:CCGGCGCATTGACCGCACAAACTTTCTCGAGAAAGTTTGTGCGGTCAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)