EMAIL THIS PAGE TO A FRIEND

Adam24

41 Gene Product Result for
Gene ID:
Rat(290774) ADAM metallopeptidase domain 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024871 MISSION® esiRNA targeting mouse Adam24 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001064767 Rosetta Predictions rat pricing
XM_224892 Rosetta Predictions rat pricing
NM_010086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311675 predicted 779
2 SASI_Rn02_00311676 predicted 751
3 SASI_Rn02_00311677 predicted 731
4 SASI_Rn02_00311678 predicted 1004
5 SASI_Rn02_00311679 predicted 1336
6 SASI_Rn02_00311680 predicted 394
7 SASI_Rn02_00311681 predicted 533
8 SASI_Rn02_00311682 predicted 715
9 SASI_Rn02_00311683 predicted 648
10 SASI_Rn02_00311684 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382360 predicted 776
2 SASI_Rn02_00382361 predicted 750
3 SASI_Rn02_00382362 predicted 732
4 SASI_Rn02_00382363 predicted 1008
5 SASI_Rn02_00382364 predicted 1339
6 SASI_Rn01_00189245 predicted 395
7 SASI_Rn01_00189246 predicted 534
8 SASI_Rn02_00382365 predicted 716
9 SASI_Rn02_00382366 predicted 648
10 SASI_Rn02_00382367 predicted 672
11 SASI_Rn01_00189241 predicted 487
12 SASI_Rn01_00189242 predicted 282
13 SASI_Rn01_00189243 predicted 391
14 SASI_Rn01_00189244 predicted 412
15 SASI_Rn01_00189247 predicted 294
16 SASI_Rn01_00189248 predicted 363
17 SASI_Rn01_00189249 predicted 218
18 SASI_Rn01_00189250 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160952 predicted 291
2 SASI_Mm01_00160953 predicted 2482
3 SASI_Mm01_00160954 predicted 1880
4 SASI_Mm01_00160955 predicted 1812
5 SASI_Mm01_00160956 predicted 1168
6 SASI_Mm01_00160958 predicted 2407
7 SASI_Mm01_00160959 predicted 1760
8 SASI_Mm01_00160960 predicted 2400
9 SASI_Mm02_00317777 predicted 1303
10 SASI_Mm02_00317778 predicted 455
11 SASI_Mm01_00160957 predicted 314
12 SASI_Mm01_00160961 predicted 1226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010086
Adam24 MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-2045s21c1
Sequence:CCGGATAAGCCAAGTTGGGTAAATGCTCGAGCATTTACCCAACTTGGCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010086.2-2591s1c1
Sequence:CCGGGCTTCACTTCTTCAACTTCAACTCGAGTTGAAGTTGAAGAAGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-1511s21c1
Sequence:CCGGGACTATGTTGTAACCGCAAATCTCGAGATTTGCGGTTACAACATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-2252s1c1
Sequence:CCGGCCTAACGTCATAATTTGGTTACTCGAGTAACCAAATTATGACGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-296s21c1
Sequence:CCGGTGAAACCCTTGAGGGTAATTGCTCGAGCAATTACCCTCAAGGGTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-1242s1c1
Sequence:CCGGGCGGAGAAGAATCATGTTTAACTCGAGTTAAACATGATTCTTCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-803s1c1
Sequence:CCGGGCATTGGTTATAGACCATGAACTCGAGTTCATGGTCTATAACCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-2327s1c1
Sequence:CCGGGCCACTAATAAATCACGTGAACTCGAGTTCACGTGATTTATTAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010086
Adam24 MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-2045s21c1
Sequence:CCGGATAAGCCAAGTTGGGTAAATGCTCGAGCATTTACCCAACTTGGCTTATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010086.2-2591s1c1
Sequence:CCGGGCTTCACTTCTTCAACTTCAACTCGAGTTGAAGTTGAAGAAGTGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000431372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-1511s21c1
Sequence:CCGGGACTATGTTGTAACCGCAAATCTCGAGATTTGCGGTTACAACATAGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-2252s1c1
Sequence:CCGGCCTAACGTCATAATTTGGTTACTCGAGTAACCAAATTATGACGTTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-296s21c1
Sequence:CCGGTGAAACCCTTGAGGGTAATTGCTCGAGCAATTACCCTCAAGGGTTTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-1242s1c1
Sequence:CCGGGCGGAGAAGAATCATGTTTAACTCGAGTTAAACATGATTCTTCTCCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-803s1c1
Sequence:CCGGGCATTGGTTATAGACCATGAACTCGAGTTCATGGTCTATAACCAATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-2327s1c1
Sequence:CCGGGCCACTAATAAATCACGTGAACTCGAGTTCACGTGATTTATTAGTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010086
Adam24 MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-2045s21c1
Sequence:CCGGATAAGCCAAGTTGGGTAAATGCTCGAGCATTTACCCAACTTGGCTTATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010086.2-2591s1c1
Sequence:CCGGGCTTCACTTCTTCAACTTCAACTCGAGTTGAAGTTGAAGAAGTGAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-1511s21c1
Sequence:CCGGGACTATGTTGTAACCGCAAATCTCGAGATTTGCGGTTACAACATAGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-2252s1c1
Sequence:CCGGCCTAACGTCATAATTTGGTTACTCGAGTAACCAAATTATGACGTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000421498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010086.4-296s21c1
Sequence:CCGGTGAAACCCTTGAGGGTAATTGCTCGAGCAATTACCCTCAAGGGTTTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-1242s1c1
Sequence:CCGGGCGGAGAAGAATCATGTTTAACTCGAGTTAAACATGATTCTTCTCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-803s1c1
Sequence:CCGGGCATTGGTTATAGACCATGAACTCGAGTTCATGGTCTATAACCAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010086.2-2327s1c1
Sequence:CCGGGCCACTAATAAATCACGTGAACTCGAGTTCACGTGATTTATTAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???