EMAIL THIS PAGE TO A FRIEND

Adam25

23 Gene Product Result for
Gene ID:
Rat(688469) a disintegrin and metallopeptidase domain 25 (testase 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU157591 MISSION® esiRNA targeting mouse Adam25 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001067075 Rosetta Predictions rat pricing
NM_011781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319781 predicted 654
2 SASI_Rn02_00319782 predicted 1409
3 SASI_Rn02_00319783 predicted 1734
4 SASI_Rn02_00319784 predicted 915
5 SASI_Rn02_00319785 predicted 1799
6 SASI_Rn02_00319786 predicted 1273
7 SASI_Rn02_00319787 predicted 563
8 SASI_Rn02_00319788 predicted 860
9 SASI_Rn02_00319789 predicted 889
10 SASI_Rn02_00319790 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111788 predicted 2244
2 SASI_Mm01_00111789 predicted 1332
3 SASI_Mm01_00111790 predicted 1877
4 SASI_Mm01_00111792 predicted 1075
5 SASI_Mm01_00111793 predicted 2071
6 SASI_Mm01_00111794 predicted 2084
7 SASI_Mm01_00111795 predicted 818
8 SASI_Mm02_00321428 predicted 1253
9 SASI_Mm01_00111797 predicted 2389
10 SASI_Mm02_00321429 predicted 1330
11 SASI_Mm01_00111791 predicted 2389
12 SASI_Mm01_00111796 predicted 1265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011781
Adam25 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-2203s1c1
Sequence:CCGGGCCCTCCGAACTATACTGAAACTCGAGTTTCAGTATAGTTCGGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-543s1c1
Sequence:CCGGCCAGAGTCTATGGTTGCTATTCTCGAGAATAGCAACCATAGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-309s1c1
Sequence:CCGGCCAGAAGTAGTGATACCCTTACTCGAGTAAGGGTATCACTACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-2088s1c1
Sequence:CCGGCCTAAGACATGCAACATGAAACTCGAGTTTCATGTTGCATGTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-1258s1c1
Sequence:CCGGGTGGAACAAAGATTTGCTTAACTCGAGTTAAGCAAATCTTTGTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011781
Adam25 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-2203s1c1
Sequence:CCGGGCCCTCCGAACTATACTGAAACTCGAGTTTCAGTATAGTTCGGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-543s1c1
Sequence:CCGGCCAGAGTCTATGGTTGCTATTCTCGAGAATAGCAACCATAGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-309s1c1
Sequence:CCGGCCAGAAGTAGTGATACCCTTACTCGAGTAAGGGTATCACTACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-2088s1c1
Sequence:CCGGCCTAAGACATGCAACATGAAACTCGAGTTTCATGTTGCATGTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-1258s1c1
Sequence:CCGGGTGGAACAAAGATTTGCTTAACTCGAGTTAAGCAAATCTTTGTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011781
Adam25 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-2203s1c1
Sequence:CCGGGCCCTCCGAACTATACTGAAACTCGAGTTTCAGTATAGTTCGGAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-543s1c1
Sequence:CCGGCCAGAGTCTATGGTTGCTATTCTCGAGAATAGCAACCATAGACTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-309s1c1
Sequence:CCGGCCAGAAGTAGTGATACCCTTACTCGAGTAAGGGTATCACTACTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-2088s1c1
Sequence:CCGGCCTAAGACATGCAACATGAAACTCGAGTTTCATGTTGCATGTCTTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011781.1-1258s1c1
Sequence:CCGGGTGGAACAAAGATTTGCTTAACTCGAGTTAAGCAAATCTTTGTTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???