EMAIL THIS PAGE TO A FRIEND

Adam26b

9 Gene Product Result for
Species: Mouse Adam26b(382007)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_356073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU091151 MISSION® esiRNA targeting mouse Adam26b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028274 predicted 515
2 SASI_Mm01_00028278 predicted 390
3 SASI_Mm01_00028275 predicted 537
4 SASI_Mm01_00028276 predicted 2153
5 SASI_Mm01_00028279 predicted 380
6 SASI_Mm01_00028280 predicted 398
7 SASI_Mm01_00028277 predicted 2358
8 SASI_Mm01_00028281 predicted 2288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356073
Adam26b MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-2168s1c1
Sequence:CCGGGTAACTGTACAACCAAGTTATCTCGAGATAACTTGGTTGTACAGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-1045s1c1
Sequence:CCGGGCTCTTGAAATATGGAATGAACTCGAGTTCATTCCATATTTCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-1042s1c1
Sequence:CCGGACTGCTCTTGAAATATGGAATCTCGAGATTCCATATTTCAAGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-522s1c1
Sequence:CCGGCTTGATGTCCAGAAACTTAATCTCGAGATTAAGTTTCTGGACATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-397s1c1
Sequence:CCGGCCAGAAGTAGTGACACCTTTACTCGAGTAAAGGTGTCACTACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356073
Adam26b MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-2168s1c1
Sequence:CCGGGTAACTGTACAACCAAGTTATCTCGAGATAACTTGGTTGTACAGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-1045s1c1
Sequence:CCGGGCTCTTGAAATATGGAATGAACTCGAGTTCATTCCATATTTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-1042s1c1
Sequence:CCGGACTGCTCTTGAAATATGGAATCTCGAGATTCCATATTTCAAGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-522s1c1
Sequence:CCGGCTTGATGTCCAGAAACTTAATCTCGAGATTAAGTTTCTGGACATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-397s1c1
Sequence:CCGGCCAGAAGTAGTGACACCTTTACTCGAGTAAAGGTGTCACTACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356073
Adam26b MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-2168s1c1
Sequence:CCGGGTAACTGTACAACCAAGTTATCTCGAGATAACTTGGTTGTACAGTTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-1045s1c1
Sequence:CCGGGCTCTTGAAATATGGAATGAACTCGAGTTCATTCCATATTTCAAGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-1042s1c1
Sequence:CCGGACTGCTCTTGAAATATGGAATCTCGAGATTCCATATTTCAAGAGCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-522s1c1
Sequence:CCGGCTTGATGTCCAGAAACTTAATCTCGAGATTAAGTTTCTGGACATCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000087530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356073.2-397s1c1
Sequence:CCGGCCAGAAGTAGTGACACCTTTACTCGAGTAAAGGTGTCACTACTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???