EMAIL THIS PAGE TO A FRIEND

ADAM32

ADAM metallopeptidase domain 32

65 Gene Product Result for
UniProtKB ID: Q8TC27, Q8TC42
Gene ID:
Mouse(353188) a disintegrin and metallopeptidase domain 32
Rat(361170) ADAM metallopeptidase domain 32
chicken(426784) ADAM metallopeptidase domain 32
cow(520297) ADAM metallopeptidase domain 32
Horse(100057132) ADAM metallopeptidase domain 32
domestic cat(101098220) ADAM metallopeptidase domain 32
dog(475578) ADAM metallopeptidase domain 32
sheep(101115508) ADAM metallopeptidase domain 32
domestic guinea pig(100735053) ADAM metallopeptidase domain 32
naked mole-rat(101719058) ADAM metallopeptidase domain 32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145004 Rosetta Predictions human pricing
XM_001060880 Rosetta Predictions rat pricing
XM_001072010 Rosetta Predictions rat pricing
NM_153397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024747 predicted 1085
2 SASI_Hs01_00024748 predicted 1831
3 SASI_Hs01_00024749 predicted 879
4 SASI_Hs01_00024750 predicted 1993
5 SASI_Hs02_00364843 predicted 2440
6 SASI_Hs02_00364844 predicted 2320
7 SASI_Hs01_00024752 predicted 588
8 SASI_Hs01_00024753 predicted 2043
9 SASI_Hs01_00024754 predicted 419
10 SASI_Hs01_00024755 predicted 506
11 SASI_Hs01_00024751 predicted 2273
12 SASI_Hs01_00024756 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298019 predicted 405
2 SASI_Rn02_00298020 predicted 408
3 SASI_Rn02_00298021 predicted 340
4 SASI_Rn02_00298022 predicted 369
5 SASI_Rn02_00298023 predicted 342
6 SASI_Rn02_00298024 predicted 412
7 SASI_Rn02_00298025 predicted 332
8 SASI_Rn02_00298026 predicted 407
9 SASI_Rn02_00298027 predicted 371
10 SASI_Rn02_00298028 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337358 predicted 1453
2 SASI_Rn02_00337359 predicted 652
3 SASI_Rn02_00337360 predicted 1976
4 SASI_Rn02_00337361 predicted 2035
5 SASI_Rn02_00337362 predicted 266
6 SASI_Rn02_00337363 predicted 1898
7 SASI_Rn02_00337364 predicted 1823
8 SASI_Rn02_00337365 predicted 943
9 SASI_Rn02_00337366 predicted 1558
10 SASI_Rn02_00337367 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343179 predicted 1958
2 SASI_Mm01_00061386 predicted 1850
3 SASI_Mm01_00061387 predicted 1811
4 SASI_Mm01_00061388 predicted 1690
5 SASI_Mm01_00061389 predicted 1683
6 SASI_Mm01_00061390 predicted 786
7 SASI_Mm01_00061392 predicted 1950
8 SASI_Mm01_00061394 predicted 1252
9 SASI_Mm01_00061395 predicted 1637
10 SASI_Mm02_00343180 predicted 878
11 SASI_Mm01_00061391 predicted 484
12 SASI_Mm01_00061393 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145004
ADAM32 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 32
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145004.5-1123s21c1
Sequence:CCGGCAATGTGTATTACTCGTTATTCTCGAGAATAACGAGTAATACACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-2283s1c1
Sequence:CCGGGCGAATCTAAATCGGAAGGTACTCGAGTACCTTCCGATTTAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-782s1c1
Sequence:CCGGGCAAATTCAATGTTCACCCAACTCGAGTTGGGTGAACATTGAATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-1622s1c1
Sequence:CCGGGCACGTTGTGAGAGTGTATTTCTCGAGAAATACACTCTCACAACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-2379s1c1
Sequence:CCGGGCAGCAGTCAAGCTGATACTACTCGAGTAGTATCAGCTTGACTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-1860s1c1
Sequence:CCGGGCATAACTGTAGACTACAAATCTCGAGATTTGTAGTCTACAGTTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145004
ADAM32 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 32
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145004.5-1123s21c1
Sequence:CCGGCAATGTGTATTACTCGTTATTCTCGAGAATAACGAGTAATACACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-2283s1c1
Sequence:CCGGGCGAATCTAAATCGGAAGGTACTCGAGTACCTTCCGATTTAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-782s1c1
Sequence:CCGGGCAAATTCAATGTTCACCCAACTCGAGTTGGGTGAACATTGAATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-1622s1c1
Sequence:CCGGGCACGTTGTGAGAGTGTATTTCTCGAGAAATACACTCTCACAACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-2379s1c1
Sequence:CCGGGCAGCAGTCAAGCTGATACTACTCGAGTAGTATCAGCTTGACTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-1860s1c1
Sequence:CCGGGCATAACTGTAGACTACAAATCTCGAGATTTGTAGTCTACAGTTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145004
ADAM32 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 32
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145004.5-1123s21c1
Sequence:CCGGCAATGTGTATTACTCGTTATTCTCGAGAATAACGAGTAATACACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-2283s1c1
Sequence:CCGGGCGAATCTAAATCGGAAGGTACTCGAGTACCTTCCGATTTAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-782s1c1
Sequence:CCGGGCAAATTCAATGTTCACCCAACTCGAGTTGGGTGAACATTGAATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-1622s1c1
Sequence:CCGGGCACGTTGTGAGAGTGTATTTCTCGAGAAATACACTCTCACAACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-2379s1c1
Sequence:CCGGGCAGCAGTCAAGCTGATACTACTCGAGTAGTATCAGCTTGACTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145004.4-1860s1c1
Sequence:CCGGGCATAACTGTAGACTACAAATCTCGAGATTTGTAGTCTACAGTTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153397
ADAM32 MISSION shRNA Bacterial Glycerol Stock
ADAM metallopeptidase domain 32
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153397.1-2292s1c1
Sequence:CCGGAGGAGGAAGAGGAAGAGGAAACTCGAGTTTCCTCTTCCTCTTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-1301s1c1
Sequence:CCGGCCCTCATCAACATGCTGCAAACTCGAGTTTGCAGCATGTTGATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-984s1c1
Sequence:CCGGCGTATGATGAGCCTGAGAAATCTCGAGATTTCTCAGGCTCATCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-1857s1c1
Sequence:CCGGCGAGATTTCTTAGGGATCAATCTCGAGATTGATCCCTAAGAAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-65s1c1
Sequence:CCGGCCCGAGTCTCAAAGTTCATTTCTCGAGAAATGAACTTTGAGACTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153397
ADAM32 MISSION shRNA shRNA Plasmid DNA
ADAM metallopeptidase domain 32
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153397.1-2292s1c1
Sequence:CCGGAGGAGGAAGAGGAAGAGGAAACTCGAGTTTCCTCTTCCTCTTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-1301s1c1
Sequence:CCGGCCCTCATCAACATGCTGCAAACTCGAGTTTGCAGCATGTTGATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-984s1c1
Sequence:CCGGCGTATGATGAGCCTGAGAAATCTCGAGATTTCTCAGGCTCATCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-1857s1c1
Sequence:CCGGCGAGATTTCTTAGGGATCAATCTCGAGATTGATCCCTAAGAAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-65s1c1
Sequence:CCGGCCCGAGTCTCAAAGTTCATTTCTCGAGAAATGAACTTTGAGACTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153397
ADAM32 MISSION shRNA Lentiviral Transduction Particles
ADAM metallopeptidase domain 32
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087583    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153397.1-2292s1c1
Sequence:CCGGAGGAGGAAGAGGAAGAGGAAACTCGAGTTTCCTCTTCCTCTTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-1301s1c1
Sequence:CCGGCCCTCATCAACATGCTGCAAACTCGAGTTTGCAGCATGTTGATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-984s1c1
Sequence:CCGGCGTATGATGAGCCTGAGAAATCTCGAGATTTCTCAGGCTCATCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-1857s1c1
Sequence:CCGGCGAGATTTCTTAGGGATCAATCTCGAGATTGATCCCTAAGAAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153397.1-65s1c1
Sequence:CCGGCCCGAGTCTCAAAGTTCATTTCTCGAGAAATGAACTTTGAGACTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)