EMAIL THIS PAGE TO A FRIEND

Adam34

7 Gene Product Result for
Gene ID:
Rat(685846) a disintegrin and metallopeptidase domain 34
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_142966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_142966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_142966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU159301 MISSION® esiRNA targeting mouse Adam34 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107393 predicted 2118
2 SASI_Mm01_00107394 predicted 2138
3 SASI_Mm01_00107398 predicted 1206
4 SASI_Mm01_00107395 predicted 1231
5 SASI_Mm01_00107396 predicted 1108
6 SASI_Mm01_00107397 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_142966
Adam34 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1285s1c1
Sequence:CCGGGTGGGCTAAGTAGCTGCATAACTCGAGTTATGCAGCTACTTAGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-2047s1c1
Sequence:CCGGCAACTTGTGGTCCAGACTATTCTCGAGAATAGTCTGGACCACAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1044s1c1
Sequence:CCGGGCATTCTGTAATTGGAAGATACTCGAGTATCTTCCAATTACAGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1830s1c1
Sequence:CCGGCGCTTTGGAAACTGTGGCAATCTCGAGATTGCCACAGTTTCCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-892s1c1
Sequence:CCGGCCACGACTTGTATTCAAGATACTCGAGTATCTTGAATACAAGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_142966
Adam34 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1285s1c1
Sequence:CCGGGTGGGCTAAGTAGCTGCATAACTCGAGTTATGCAGCTACTTAGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-2047s1c1
Sequence:CCGGCAACTTGTGGTCCAGACTATTCTCGAGAATAGTCTGGACCACAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1044s1c1
Sequence:CCGGGCATTCTGTAATTGGAAGATACTCGAGTATCTTCCAATTACAGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1830s1c1
Sequence:CCGGCGCTTTGGAAACTGTGGCAATCTCGAGATTGCCACAGTTTCCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-892s1c1
Sequence:CCGGCCACGACTTGTATTCAAGATACTCGAGTATCTTGAATACAAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_142966
Adam34 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1285s1c1
Sequence:CCGGGTGGGCTAAGTAGCTGCATAACTCGAGTTATGCAGCTACTTAGCCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-2047s1c1
Sequence:CCGGCAACTTGTGGTCCAGACTATTCTCGAGAATAGTCTGGACCACAAGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1044s1c1
Sequence:CCGGGCATTCTGTAATTGGAAGATACTCGAGTATCTTCCAATTACAGAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-1830s1c1
Sequence:CCGGCGCTTTGGAAACTGTGGCAATCTCGAGATTGCCACAGTTTCCAAAGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142966.3-892s1c1
Sequence:CCGGCCACGACTTGTATTCAAGATACTCGAGTATCTTGAATACAAGTCGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???