EMAIL THIS PAGE TO A FRIEND

Adam39

10 Gene Product Result for
Species: Mouse Adam39(546055)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU215051 MISSION® esiRNA targeting mouse Adam39 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036067 predicted 849
2 SASI_Mm01_00036068 predicted 1548
3 SASI_Mm01_00036069 predicted 1703
4 SASI_Mm01_00036070 predicted 2069
5 SASI_Mm01_00036071 predicted 1339
6 SASI_Mm01_00036072 predicted 1121
7 SASI_Mm01_00036073 predicted 1542
8 SASI_Mm02_00287854 predicted 2245
9 SASI_Mm01_00036074 predicted 1679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025380
Adam39 MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-1945s1c1
Sequence:CCGGCCCACTACATGCAGCATGAAACTCGAGTTTCATGCTGCATGTAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-400s1c1
Sequence:CCGGCCAGAGTCTATGGTTGCTATTCTCGAGAATAGCAACCATAGACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-166s1c1
Sequence:CCGGCCAGAAGTAGTGATACCCTTACTCGAGTAAGGGTATCACTACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-696s1c1
Sequence:CCGGGCGAGTTCATTATCATAACAACTCGAGTTGTTATGATAATGAACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025380
Adam39 MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-1945s1c1
Sequence:CCGGCCCACTACATGCAGCATGAAACTCGAGTTTCATGCTGCATGTAGTGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000192245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-400s1c1
Sequence:CCGGCCAGAGTCTATGGTTGCTATTCTCGAGAATAGCAACCATAGACTCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000201046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-166s1c1
Sequence:CCGGCCAGAAGTAGTGATACCCTTACTCGAGTAAGGGTATCACTACTTCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000191780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-696s1c1
Sequence:CCGGGCGAGTTCATTATCATAACAACTCGAGTTGTTATGATAATGAACTCGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025380
Adam39 MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-1945s1c1
Sequence:CCGGCCCACTACATGCAGCATGAAACTCGAGTTTCATGCTGCATGTAGTGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-400s1c1
Sequence:CCGGCCAGAGTCTATGGTTGCTATTCTCGAGAATAGCAACCATAGACTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-166s1c1
Sequence:CCGGCCAGAAGTAGTGATACCCTTACTCGAGTAAGGGTATCACTACTTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000191780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025380.1-696s1c1
Sequence:CCGGGCGAGTTCATTATCATAACAACTCGAGTTGTTATGATAATGAACTCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???