EMAIL THIS PAGE TO A FRIEND

Adam4

28 Gene Product Result for
Gene ID:
Rat(57022) a disintegrin and metalloprotease domain 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU202991 MISSION® esiRNA targeting mouse Adam4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020305 Rosetta Predictions rat pricing
NM_009620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038907 predicted 706
2 SASI_Rn02_00262548 predicted 1996
3 SASI_Rn01_00038908 predicted 907
4 SASI_Rn01_00038909 predicted 740
5 SASI_Rn02_00262549 predicted 1972
6 SASI_Rn01_00038910 predicted 825
7 SASI_Rn02_00262550 predicted 854
8 SASI_Rn01_00038912 predicted 748
9 SASI_Rn01_00038913 predicted 990
10 SASI_Rn01_00038915 predicted 892
11 SASI_Rn01_00038911 predicted 1613
12 SASI_Rn01_00038914 predicted 518
13 SASI_Rn01_00038916 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195482 predicted 731
2 SASI_Mm01_00195483 predicted 812
3 SASI_Mm01_00195485 predicted 928
4 SASI_Mm01_00195486 predicted 946
5 SASI_Mm02_00316567 predicted 2069
6 SASI_Mm02_00316568 predicted 1237
7 SASI_Mm01_00195489 predicted 408
8 SASI_Mm01_00195490 predicted 977
9 SASI_Mm02_00316569 predicted 1942
10 SASI_Mm02_00316570 predicted 1184
11 SASI_Mm01_00195484 predicted 1379
12 SASI_Mm01_00195487 predicted 1371
13 SASI_Mm01_00195488 predicted 1587
14 SASI_Mm01_00195491 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009620
Adam4 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-814s1c1
Sequence:CCGGCGTGGTGTATGGATTTGGAATCTCGAGATTCCAAATCCATACACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-642s1c1
Sequence:CCGGCCCTGTATATTTGTGGCGTTACTCGAGTAACGCCACAAATATACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-1998s1c1
Sequence:CCGGCAACATTAGTTCGTGTAACTTCTCGAGAAGTTACACGAACTAATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-153s1c1
Sequence:CCGGGCGCTTCTCTACCTCTGAAATCTCGAGATTTCAGAGGTAGAGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-1199s1c1
Sequence:CCGGGTTCCCATAATGAGTTACATACTCGAGTATGTAACTCATTATGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009620
Adam4 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-814s1c1
Sequence:CCGGCGTGGTGTATGGATTTGGAATCTCGAGATTCCAAATCCATACACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-642s1c1
Sequence:CCGGCCCTGTATATTTGTGGCGTTACTCGAGTAACGCCACAAATATACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-1998s1c1
Sequence:CCGGCAACATTAGTTCGTGTAACTTCTCGAGAAGTTACACGAACTAATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-153s1c1
Sequence:CCGGGCGCTTCTCTACCTCTGAAATCTCGAGATTTCAGAGGTAGAGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-1199s1c1
Sequence:CCGGGTTCCCATAATGAGTTACATACTCGAGTATGTAACTCATTATGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009620
Adam4 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-814s1c1
Sequence:CCGGCGTGGTGTATGGATTTGGAATCTCGAGATTCCAAATCCATACACCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-642s1c1
Sequence:CCGGCCCTGTATATTTGTGGCGTTACTCGAGTAACGCCACAAATATACAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-1998s1c1
Sequence:CCGGCAACATTAGTTCGTGTAACTTCTCGAGAAGTTACACGAACTAATGTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-153s1c1
Sequence:CCGGGCGCTTCTCTACCTCTGAAATCTCGAGATTTCAGAGGTAGAGAAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009620.1-1199s1c1
Sequence:CCGGGTTCCCATAATGAGTTACATACTCGAGTATGTAACTCATTATGGGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???