EMAIL THIS PAGE TO A FRIEND

ADAM6A

7 Gene Product Result for
Species: Mouse Adam6a(238406), Domestic Rabbit ADAM6A(100303770)
Gene ID:
Domestic Rabbit(100303770) cellular disintegrin ADAM 6e
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU204201 MISSION® esiRNA targeting mouse Adam6a mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091735 predicted 1063
2 SASI_Mm01_00091736 predicted 1075
3 SASI_Mm01_00091737 predicted 773
4 SASI_Mm01_00091738 predicted 531
5 SASI_Mm01_00091739 predicted 2466
6 SASI_Mm01_00091740 predicted 2385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174885
ADAM6A MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-1031s1c1
Sequence:CCGGGCCAGGAGATGATGCTGTTAACTCGAGTTAACAGCATCATCTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-2342s1c1
Sequence:CCGGGCAAGAACAAGCAAAGGACAACTCGAGTTGTCCTTTGCTTGTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-1528s1c1
Sequence:CCGGGCAGACCTATCCAGAACATATCTCGAGATATGTTCTGGATAGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-2172s1c1
Sequence:CCGGCCGGTTCAAAGGCGCATAATACTCGAGTATTATGCGCCTTTGAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-957s1c1
Sequence:CCGGGCTCATACTTTCTATGAGAGACTCGAGTCTCTCATAGAAAGTATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174885
ADAM6A MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-1031s1c1
Sequence:CCGGGCCAGGAGATGATGCTGTTAACTCGAGTTAACAGCATCATCTCCTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-2342s1c1
Sequence:CCGGGCAAGAACAAGCAAAGGACAACTCGAGTTGTCCTTTGCTTGTTCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-1528s1c1
Sequence:CCGGGCAGACCTATCCAGAACATATCTCGAGATATGTTCTGGATAGGTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-2172s1c1
Sequence:CCGGCCGGTTCAAAGGCGCATAATACTCGAGTATTATGCGCCTTTGAACCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000032723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-957s1c1
Sequence:CCGGGCTCATACTTTCTATGAGAGACTCGAGTCTCTCATAGAAAGTATGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174885
ADAM6A MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-1031s1c1
Sequence:CCGGGCCAGGAGATGATGCTGTTAACTCGAGTTAACAGCATCATCTCCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-2342s1c1
Sequence:CCGGGCAAGAACAAGCAAAGGACAACTCGAGTTGTCCTTTGCTTGTTCTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-1528s1c1
Sequence:CCGGGCAGACCTATCCAGAACATATCTCGAGATATGTTCTGGATAGGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-2172s1c1
Sequence:CCGGCCGGTTCAAAGGCGCATAATACTCGAGTATTATGCGCCTTTGAACCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000032723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174885.2-957s1c1
Sequence:CCGGGCTCATACTTTCTATGAGAGACTCGAGTCTCTCATAGAAAGTATGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???